For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 119 bp
Wild Type = 128 bp
>chr15:36933756-36933883 128bp CTGGCATTCCACTGTGTTATCT TCACAATGCATGCTCAACAG
Sequence
Wt Sequence:ctggcattccactgtgttatctgttTttaccaatgatatttgaactgtctggttttagaacaggttctgtaaacatccttttatacattgatgtacatacatttgatactgttgagcatgcattgtga
Mutant Sequence:ctggcattccactgtgttatctgttTGtaaaacagtatcctgccctttgtagaataaaggtgtccttgtggagtttataatcaattcactttggttgcattcttagtgtggctaaggct
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35349 | CTG GCA TTC CAC TGT GTT ATC T | Common | A | |||
| 35350 | AGC CTT AGC CAC ACT AAG AAT G | Mutant Reverse | A | |||
| 35351 | TCA CAA TGC ATG CTC AAC AG | Wild type Reverse | A | |||
| 35352 | Fluorophore-1 | AGA ATA AAG GTG TCC TTG TGG AGT T | Quencher-1 | MUT Probe | ||
| 35353 | Fluorophore-2 | TGA ACT GTC TGG TTT TAG AAC AGG T | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35349 | 0.40 uM |
| 35350 | 0.40 uM |
| 35351 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.