For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
WT - A (B6)
Mut - G (CBA/CaJ)
Sequence
ATCATCACGGACATGCAAGACATGGATCCTATCTTCATCAACCTGCCCTACAGTACTAACATCTACGAGCACTCTCCTCCA/Ggtgagccccgcccccagccccagagcaggaagacaaatgcctgtcctgcgtgggttctctagcccgtgctggggatggctgtggacttaagc
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 17587 | ATC ATC ACG GAC ATG CAA GA | Forward | A | |||
| 17588 | GCT TAA GTC CAC AGC CAT CC | Reverse | A | |||
| 17589 | Fluorophore-1 | TCT CCT CCA GTG AGC CC | Quencher-1 | WT Probe | ||
| 17590 | Fluorophore-2 | TCT CCT CCG GTG AGC CC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 17587 | 0.40 uM |
| 17588 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.