For in-depth product & services help, ask our
Technical Information Scientists
WT=(G/G)(A/A) (human)
Mutant=(T/T)(C/C)-JR 3375 (APP695)
Mut = ~250 bp
Mouse wt will not produce PCR product
GTTCTGGGTTGACAAATATCAAGACGGAGGAGATCTCTG
AAGTGaa(g/t)(a/c)tgGATGCAGAATTCCGACATGACTCAGG
ATATGAAGTTCATCATCAAAAATTG
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 28825 | TGG ATG TGT ACT GTT TCT TCT TCA | Transgene Reverse | A | |||
| oIMR3610 | AGG ACT GAC CAC TCG ACC AG | Transgene Forward | A |
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 28825 | 0.50 uM |
| oIMR3610 | 0.50 uM |
| Glycerol | 6.50 % |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.