Protocol 37869: Probe Assay - Grm7<Tg(SMN2)89Ahmb>-Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr6:111099925+111100076 152bp CAAACCAAAGCTCCAGAATC GTGGCCAAATGTCAGTCACC

Mut= 158 bp

Wt= 152 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence:

tctacattactgacctaccagggatgaggcattaggggaaatttttccaactcagtgtcatagcttctgtgtgctgtatgaactgataagttaacttttaacactgtataaattctgaaaacaaaccaaagctccagaatctttgaaaaatgagtttttgtttaagaaaccagaaatatgtagcctcccaaattgtcTGtaccctctgagttctcaattatttttaagtgtctgtgctacttagaggtggccaggtgactgacatttggccactatgaaggaagaaac

Mutant Sequence:

GTATAAATTCTGAAAACAAACCAAAGCTCCAGAATCTTTGAAAAATGAGTTTTTGTTTAAGAAACCAGAAATATGTAGCCTCCCAAATTgtctCAAAGTAATCTCTGTCTGATCCCTTAATGAAGGATCTCTTCAAACACAGCAACTTTTGTCTGTCTTCTGAACGTAGGTACAGCTGTGGCTG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
52364 CAA ACC AAA GCT CCA GAA TC Common A
52365 GTG GCC AAA TGT CAG TCA CC Wild type Reverse A
52366 TGT ACC TAC GTT CAG AAG ACA GAC Mutant Reverse A
52367 Fluorophore-1 CCC AAA TTG TCT GTA CCC TCT GAG Quencher-1 WT Probe
52368 Fluorophore-2 CCC TTA ATG AAG GAT CTC TTC AAA CAC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00
Kapa Probe Fast QPCR 1.00 X
ddH2O
ddH2O
Primer 0.42
52364 0.40 uM
Primer 0.42
52365 0.40 uM
Primer 0.42
52366 0.40 uM
Primer 0.42
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA
Probe 0.17
Probe 0.17
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
1 95.0 --
2 95.0 --
2 95.0 --
3 60.0 -- repeat steps 2-3 for 40 cycles
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
007222 B6.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN1*A2G)2023Ahmb/J
006964 B6.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/J
006773 B6.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd/J
006385 B6;129P2-Syt1tm3Sud/J
006386 B6;129P2-Syt1tm5Sud/J
008209 FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(ACTA1-SMN)69Ahmb/J
007968 FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN1*A2G)2023Ahmb/2J
005026 FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN1*A2G)2023Ahmb/J
007952 FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/2J
005025 FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/J
031906 FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2-SMN1*T274I)5Ahmb/J
007949 FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd/2J
005024 FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd/J
030214 FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Prnp-PLS3)14Ahmb Tg(SMN2*delta7)4299Ahmb/J
030970 FVB.Cg-Mapk10tm1Flv Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/LganJ
031907 STOCK Grm7Tg(SMN2)89Ahmb Tg(SMN2-SMN1*Q282A)2Ahmb Smn1tm1Msd/J
008203 STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(ACTA1-SMN)63Ahmb/J
032003 STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Hlxb9-GFP)1Tmj Tg(SMN2*delta7)4299Ahmb/J
006570 STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Hlxb9-GFP)1Tmj/J
008212 STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Prnp-SMN)92Ahmb/J
025102 STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch/DaschMmjax
018916 STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN1-SMN2*)16Cll/CllJ
031908 STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2-SMN1*D44V)10Ahmb/J
008783 STOCK Grm7Tg(SMN2)89Ahmb Smn1tm3(SMN2/Smn1)Mrph Tg(CAG-cre/Esr1*)5Amc Tg(SMN2*delta7)4299Ahmb/J
007951 STOCK Grm7Tg(SMN2)89Ahmb Smn1tm3(SMN2/Smn1)Mrph Tg(SMN2*delta7)4299Ahmb/J
007022 STOCK Mnx1tm4(cre)Tmj Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/J
017600 STOCK Tg(tetO-SMN2,-luc)#bAhmb/J
27 strains use this protocol