For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 267 bp
Heterozygote = 267 bp and 147 bp
Wild type = 147 bp
chr6:113052952-113053098 147bp CCTTTCTGGGAGTTCTCTGCT GGTTAGCCTTTAAGCCTGC
~650 bp product can be ignored for scoring purposes
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 16475 | GCA TTC TAG TTG TGG TTT GTC C | Mutant Forward | A | SV40 poly(A)/LSL | ||
| 67575 | CCT TTC TGG GAG TTC TCT GCT | Wild type Forward | A | ROSA26/LHA | ||
| 77125 | GGT TAG CCT TTA AGC CTG C | Wild type Reverse | A | ROSA26/RHA | ||
| 81262 | GCA TAT AAT GCA TGA CAG CCT G | Mutant Reverse | A | Tfeb cDNA |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 16475 | 0.50 uM |
| 67575 | 0.50 uM |
| 77125 | 0.50 uM |
| 81262 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.