Protocol 52279: Standard PCR Assay - Gt(ROSA)26Sor<em1(CAG-Tfeb*)Lusu>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 267 bp
Heterozygote = 267 bp and 147 bp
Wild type = 147 bp

chr6:113052952-113053098 147bp CCTTTCTGGGAGTTCTCTGCT GGTTAGCCTTTAAGCCTGC

~650 bp product can be ignored for scoring purposes 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
16475 GCA TTC TAG TTG TGG TTT GTC C Mutant Forward A SV40 poly(A)/LSL
67575 CCT TTC TGG GAG TTC TCT GCT Wild type Forward A ROSA26/LHA
77125 GGT TAG CCT TTA AGC CTG C Wild type Reverse A ROSA26/RHA
81262 GCA TAT AAT GCA TGA CAG CCT G Mutant Reverse A Tfeb cDNA

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
16475 0.50 uM
67575 0.50 uM
77125 0.50 uM
81262 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.