Protocol 51508: Probe Assay - Gt(ROSA)26Sor<tm5(CAG-Sun1/sfGFP)Nat>pre-cre Probe
Version 1.0

Notes

Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  93 bp

Wild Type = 90 bp

Sequence

Mutant Sequence:

TTGTCCAAACCCATCAATGTATCTTATCATGTCTGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCTCAATGTATCTTATCATGTCTGGATCTGTCGACCTGCAGCCAAGCTAGTATAACTTCGTATAGCATACATTATACGAAGTTATTGCGGCCGCACTACTGGCCGGCCACTACTACGC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
74524 CCT CTT CCC TCG TGA TCT Wild type Forward A
79804 GCC CAC ACA CCA GGT TAG Wild type Reverse A
79805 Fluorophore-1 CGC CCA TCT TCT AGA AAG AC Quencher-1 WT Probe
79806 ATC ATG TCT GGA TCT GTC GA Mutant Forward A
79807 GCC GGC CAG TAG TGC Mutant Reverse A
79808 Fluorophore-2 CCT GCA GCC AAG CTA GTA TAA CT Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
74524 0.40 uM
79804 0.40 uM
79806 0.40 uM
79807 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
039976 129(Cg)-Gt(ROSA)26Sortm5(CAG-Sun1/sfGFP)Nat/CdnyJ
030952 B6.129-Gt(ROSA)26Sortm5.1(CAG-Sun1/sfGFP)Nat/MmbeJ
021039 B6;129-Gt(ROSA)26Sortm5(CAG-Sun1/sfGFP)Nat/J
3 strains use this protocol