Stock No: 039271
Protocol 48698: Standard PCR Assay - Mirc24<em1Jtm>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chrX:52142761+52143084 324bp TCTAGTTGGGAGCTGTTCTAGAGTC AAGCCCTAAAGCAGGTAGGTG

Mutant = 203 bp
Heterozygote = 203 bp and 324 bp
Wild type = 324 bp

X-linked

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
73948 TCT AGT TGG GAG CTG TTC TAG AGT C Common A Mir503/Mir322/chrX
73949 AAG CCC TAA AGC AGG TAG GTG Wild type Reverse A Mir503/Mir322/chrX
73950 TTG TGA TTT GAT GTC GAT GG Mutant Reverse A Mir503/Mir322/chrX

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
73948 0.50 uM
73949 0.50 uM
73950 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.