>chr5:9569421-9569715 295bp ACGCTACATGAAACTGAAAGG TGGTCTGGTTGCCTTTCCTA
Mutant = 431 bp
Heterozygote = 431 bp and 295 bp
Wild type = 295 bp
Wt Sequence: tttgatagctgcgggatatgacaCatatgataggggcatttaatcttctgctgcggaattggcaactgtgtaagggacatgaa
Mutant Sequence: TTTGATAGCTGCGGGATATGACAtcgtgggattgtgtccgtgtcgcgaagttcctatactttctagagaataggaacttcgttcgaacataacttc
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64626 | ACG CTA CAT GAA ACT GAA AGG | Forward | A | |||
| 64627 | TGG TCT GGT TGC CTT TCC TA | Reverse | A |
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 64626 | 0.50 uM |
| 64627 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.