For in-depth product & services help, ask our
Technical Information Scientists
>chr11:104265226+104265523 298bp TTCTTAACCGCTGAGCCATC CCTTTGGGATTTTAACCATGTG
Mutant = 620 bp (Strains 35794, 36664, and 35398 H1)
Heterozygote = 620 bp (Strains 35794, 36664, and 35398 H1) and 298 bp
Wild type = 298 bp
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49773 | TTC TTA ACC GCT GAG CCA TC | Wild type Forward | A | |||
| 49774 | CCT TTG GGA TTT TAA CCA TGT G | Wild type Reverse | A | |||
| 57519 | CGG CAC ATT CCC AGA GAA CT | Mutant Forward | B | |||
| 57520 | CCT AGA GGA AAG GTC ACC G | Mutant Reverse | B |
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 49773 | 0.50 uM |
| 49774 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 57519 | 0.50 uM |
| 57520 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
| Stock Number | Strain Name |
|---|---|
| 040827 | B6(Cg)-Psen2tm2.1(PSEN2*N141I)Mdk Isr(HSA19;APOE_i4)2Mdk Isr(HSA17;MAPT*N279K)4Mdk Psen1tm4.1(PSEN1*V272A)Mdk Apptm1.1(APP)Mdk/J |
| 036664 | B6(Cg)-Isr(HSA17;rs63751011-T)3Mdk/J |
| 037778 | B6(SJL)-Apoetm1.1(APOE*4)Adiuj Isr(HSA17)2Mdk Appem1Adiuj/J |
| 035794 | B6J.B6N(Cg)-Isr(HSA17;MAPT*N279K)4Mdk/J |
| 035398 | B6J.B6N-Isr(HSA17)2Mdk/J |
| 037420 | B6J.B6N-Isr(HSA17;MAPT*P301L)5Mdk/J |
| 040815 | B6J.Cg-Isr(HSA17;MAPT*R406W)2Adiuj/J |
| 040796 | B6J.Cg-Isr(HSA17;MAPT*S320F)1Adiuj/J |
| 8 strains use this protocol | |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.