Homozygous Mutant = C/C (SJL/J)
Heterozygote = A/C
Wild type = A/A (C57BL6/J)
>chr2:99216856+99217140 285bp TGTTGGAACTTTGTGCTTGG AACAGATGTCAAATAGGACAACAC
This assay detects a SNP between C57BL6/J and SJL/J, located approximately 4.7 kb from the transgene integration site. It is capable of detecting all genotypes.
Please refer to notes within the protocol called Tg(K18-ACE2)2Prlmn-Chr2 for a complete description.
In lieu of Sanger sequencing, a HpyCH4V cut site is created by this SNP in SJL/J. Two products of 148 bp and 137 bp are present after amplification with these primers followed by restriction digest.
The Tg(K18-ACE2)2Prlmn transgene was generated by injection of (B6J x SJL)F2 blastocysts. This additional Chr2_rs13476660-SEQ assay is designed to detect a SNP present between C57BL/6J and SJL/J. This SNP maps to the duplicated region of Chr 2 linked to the (K18-ACE2)2Prlmn transgene. Therefore, this assay provides surrogate zygosity information and is capable of distinguishing hemi from hom.
ACTGGCCATGTTTGTGGTCATCTCACTAGGCCCACAAGCTTATTTCAGTAGTATTCTACTCCTTCTTAGGCATCTCTTACCAGACAAGTATTATCATTTAGCATTTG(a/c)AAAGCAGTTATTTTCCAGGGTTTTTTTGACAGAAGTGTGCGAAAAATAAGGCAAGCTACATGTAGAAACTGTTTATACCATCTTTTTTCTTATTCCCATTTTTAGAGGATAGATGTGTTGTCCTAT
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53435 | TGT TGG AAC TTT GTG CTT GG | Forward | A | |||
| 53436 | AAC AGA TGT CAA ATA GGA CAA CAC | Reverse | A |
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 53435 | 0.50 uM |
| 53436 | 0.50 uM |
| Glycerol | 6.50 % |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.