For in-depth product & services help, ask our
Technical Information Scientists
>chr11:104188843+104189134 292bp GCTCATCCCCAATTTCTTGA GTTGTTGCCTGTCCCAGACT
Mutant = 163 bp
Heterozygote = 163 bp and 292 bp
Wild type = 292 bp
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49779 | GCT CAT CCC CAA TTT CTT GA | Wild type Forward | A | Wt F | ||
| 49780 | GTT GTT GCC TGT CCC AGA CT | Wild type Reverse | A | Wt R | ||
| 49781 | CGC AGA TGT TGC AGT AGG AA | Mutant Forward | A | Mut F | ||
| 49782 | TCG GAG CTG AAC AGG ATA CA | Mutant Reverse | A | Mut R |
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 49779 | 0.50 uM |
| 49780 | 0.50 uM |
| 49781 | 0.50 uM |
| 49782 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
| Stock Number | Strain Name |
|---|---|
| 038105 | B6(Cg)-Apoetm1.1(APOE*4)Adiuj Isr(HSA17)1Mdk Appem2Aduci/AduciJ |
| 038104 | B6(Cg)-Apoetm1.1(APOE*4)Adiuj Isr(HSA17)1Mdk Apptm1.1Aduci/AduciJ |
| 036664 | B6(Cg)-Isr(HSA17;rs63751011-T)3Mdk/J |
| 037778 | B6(SJL)-Apoetm1.1(APOE*4)Adiuj Isr(HSA17)2Mdk Appem1Adiuj/J |
| 038908 | B6.Cg-Isr(HSA17)2Mdk Appem1Adiuj/J |
| 039175 | B6J.B6N(CBA)-Isr(HSA17)1Mdk Psen1tm1.1(PSEN1)Mdk Apptm1.1(APP)Mdk/J |
| 033668 | B6J.B6N(CBA)-Isr(HSA17)1Mdk/J |
| 035794 | B6J.B6N(Cg)-Isr(HSA17;MAPT*N279K)4Mdk/J |
| 035398 | B6J.B6N-Isr(HSA17)2Mdk/J |
| 037420 | B6J.B6N-Isr(HSA17;MAPT*P301L)5Mdk/J |
| 040815 | B6J.Cg-Isr(HSA17;MAPT*R406W)2Adiuj/J |
| 040796 | B6J.Cg-Isr(HSA17;MAPT*S320F)1Adiuj/J |
| 040830 | C57BL/6-Isr(HSA17)1Mdk Psen1tm2.1(PSEN1*G209V)Mdk Apptm1.1(APP)Mdk/J |
| 040831 | C57BL/6-Isr(HSA17)1Mdk Psen1tm3.1(PSEN1*A246E)Mdk Apptm1.1(APP)Mdk/J |
| 040832 | C57BL/6-Isr(HSA17)1Mdk Psen1tm4.1(PSEN1*V272A)Mdk Apptm1.1(APP)Mdk/J |
| 040833 | C57BL/6-Isr(HSA17)1Mdk Psen1tm5.1(PSEN1*E280A)Mdk Apptm1.1(APP)Mdk/J |
| 16 strains use this protocol | |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.