For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 100 bp
Wild Type = 108 bp
>chr2:101629136+101629243 108bp AAGCTGCTGCCACAATAAAG AAGGCTTGTTTAAAAGAAAAGTCA
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48593 | AAG CTG CTG CCA CAA TAA AG | Common | A | |||
| 49187 | AAG GCT TGT TTA AAA GAA AAG TCA | Wild type Reverse | A | |||
| 49188 | Fluorophore-1 | TTC CTA ACG GGG GCA G | Quencher-1 | WT Probe | ||
| 49189 | GGT ACC CTC AAT CCC CAC TT | Mutant Reverse | A | |||
| 49190 | Fluorophore-2 | AGG TGA ATA AAG ATG TCA ACA GCC | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48593 | 0.40 uM |
| 49187 | 0.40 uM |
| 49189 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.