C57BL/6J-Rag2^em3Lutzy/J

Stock number: 033526
Product name: B6J.Rag2 KO allele (Rag2 del2,465)
Strain synonyms: B6 Rag2 KO
Research areas: Cancer Research, Hematological Research, Immunology, Inflammation and Autoimmunity Research, Internal/Organ Research, Research Tools, Virology Research

Description

B6J.Rag2 KO (Rag2 del2,465) is a CRISPR/Cas9 generated indel mutation of the recombination activating gene 2 gene carrying a 2,465-nt deletion that includes all of the complete coding region. These mice may be useful in studying B and T call deficiency as well as for xenograft/transplantation.

This isogenic mutant strain is an alternative to the congenic strain Stock No. 008449 B6.Cg-Rag2^tm1.1Cgn/J.

Detailed description

To create the B6J.Rag2 KO allele (Rag2 del2,465), CRISPR/Cas9 endonuclease-mediated genome editing of recombination activating gene 2 locus (Rag2) exon 3 region resulted in a 2,465-nt deletion (GTAGTGTCTGTGATT//del 2,465//AGGTGAATAAAGATGTCAA) spanning the complete coding region of the terminal exon 3. This generates a knock-out allele and homozygotes would have greatly/completely impaired production of mature T cells or B cells.
Mice homozygous for this Rag2 KO allele lack all mature lymphocytes. Homozygotes are CD4- and CD8-, as well as lack positive cells for IgM and IgD, indicating an absence of T and B cells.
Specifically, in June 2021, analyses performed by The Jackson Laboratory on B6J.Rag2 KO homozygous mice (N=12) show the circulating T lymphocytes population is completely ablated and only ~1-2% residual CD19+ B cell population is detected in circulation. These results, using C57BL/6J isogenic mice, were not significantly different than those observed for congenic Rag2 KO mice (Stock No. 008449) in the same study.

Both heterozygous and homozygous mice are viable and fertile. If additional characterization of these B6J.Rag2 KO mice is performed, we may modify the strain description accordingly.

The Rag2 gene encodes a protein that is part of the multiprotein RAG complex which is involved in V(D)J recombination. Mutations in this gene have been useful to study immune deficiency, cancer, toxicology and xenograft/transplant research.

Development

The B6J.Rag2 KO allele (Rag2 del2,465) was generated using CRISPR/Cas9 endonuclease-mediated genome editing at The Jackson Laboratory Rare and Orphan Disease Center. Guide RNAs [TGTCTGTGATTTCCTAACGG ; TTCACCTAATCACAAGTAAC] were selected to target genomic DNA flanking the coding region of exon 3 of the recombination activating gene 2 (Rag2) on Chromosome 2 (as described for Stock No. 033524). Rag2 transcript Rag2-201 [transcript ID ENSMUST00000044031.4] was used as reference for the exon numbering and the guide/donor sequences. The proximal guide was positioned within intronic DNA preceding exon 3 and the 3' guide was positioned in the 3' UTR of the gene. A ds donor DNA containing a loxP sequence flanking the coding region of exon 3 was included as part of the targeting procedure. These sequences and Cas9 nuclease were introduced into single cell C57BL/6J zygotes and transferred to pseudopregnant females. DNA sequencing of the targeted region identified one male (founder 5178) harboring a 2,465-nt deletion (GTAGTGTCTGTGATT//del 2,465//AGGTGAATAAAGATGTCAA) that resulted in the complete loss of the coding region of exon 3 from the genome in the absence of any homologous repair involving the ds DNA donor. This founder male was bred to C57BL/6J mice (Stock No. 000664) for germline transmission. They were then bred to C57BL/6J for at least one more generation before intercrossing to establish the homozygous mutant B6J.Rag2 KO colony.

Allele

Symbol: Rag2^em3Lutzy
Name: endonuclease-mediated mutation 3, Cathy Lutz
MGI accession ID: MGI:6753157
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: Rag2 del2,465
Marker symbol: Rag2
Marker name: recombination activating gene 2
Marker synonyms: Rag-2
Chromosome: 2
Strain of origin: C57BL/6J
Molecular note: Guide RNAs [TGTCTGTGATTTCCTAACGG ; TTCACCTAATCACAAGTAAC] were selected to target intronic DNA flanking exon 3. The allele is a 2,465-nt deletion (GTAGTGTCTGTGATT//del 2,465//AGGTGAATAAAGATGTCAA) that results in the complete loss of exon 3 from the genome.