Protocol 32557: Standard PCR Assay - Igs2<tm5(CAG-tTA2,-TagBFP)Luo>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr11:3245045-3245328 284bp AGTGGGACTGCTTTTTCCAG GATCTGGGGCCATAAATGC

Mutant = 185 bp
Heterozygote = 185 bp and 284 bp
Wild type = 284 bp

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
24811 AGT GGG ACT GCT TTT TCC AG Wild type Forward A
24813 GAT CTG GGG CCA TAA ATG C Wild type Reverse A
39404 TTG ATA TGC TGC CTG CTG AC Mutant Forward A tTa2
39405 CTT AGT CAC CGC CTT CTT GG Mutant Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
24811 0.50 uM
24813 0.50 uM
39404 0.50 uM
39405 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.