For in-depth product & services help, ask our
Technical Information Scientists
This assay will NOT distinguish hemizygous from homozygous transgenic animals.
Transgene = 214 bp
Internal positive control = 521 bp
>chr19:44907672+44907885 214bp TGTGGAGCACCTTCTGTGTG AGCGCAGGTAATCCCAAAAG
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 31704 | AGT GGC CTC TTC CAG AAA TG | Internal Positive Control Forward | A | |||
| 31705 | TGC GAC TGT GTC TGA TTT CC | Internal Positive Control Reverse | A | |||
| 37041 | TGT GGA GCA CCT TCT GTG TG | Transgene Forward | A | |||
| 37042 | AGC GCA GGT AAT CCC AAA AG | Transgene Reverse | A |
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 31704 | 0.50 uM |
| 31705 | 0.50 uM |
| 37041 | 0.50 uM |
| 37042 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.