Stock No: 030232
Protocol 31517: Standard PCR Assay - Tg(APOE) Alternate1
Version 1.0

Notes

This assay will NOT distinguish hemizygous from homozygous transgenic animals.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Transgene = 214 bp

Internal positive control = 521 bp

>chr19:44907672+44907885 214bp TGTGGAGCACCTTCTGTGTG AGCGCAGGTAATCCCAAAAG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
31704 AGT GGC CTC TTC CAG AAA TG Internal Positive Control Forward A
31705 TGC GAC TGT GTC TGA TTT CC Internal Positive Control Reverse A
37041 TGT GGA GCA CCT TCT GTG TG Transgene Forward A
37042 AGC GCA GGT AAT CCC AAA AG Transgene Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
31704 0.50 uM
31705 0.50 uM
37041 0.50 uM
37042 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
029818 STOCK Apoetm1Unc Tg(APOE3*R224Q)1Her/J
030232 STOCK Tg(APOE3*R224Q)1Her/J
2 strains use this protocol