For in-depth product & services help, ask our
Technical Information Scientists
Mutant = A/A
Heterozygote = G/A
Wild type = G/G
aatatctaataaaataaaattttaaaaaattaaaactgaaagagagagacaggaggccctttctcttctgca[g/a]GCATCTAAAGA
ATATGATGAGGATTCCCTCATTCCCAGCAGCCCGGCCACAGAGACCTCAGACAACATTAGCCCTGTGGCTA
GCCCGGT
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 17262 | TAG GGG ACT TTC GGG ATA GC | Forward | A | |||
| 17263 | AGC CAC AGG GCT AAT GTT GT | Reverse | A | |||
| 17267 | Fluorophore-1 | TCT CTT CTG CAG GCA TCT AAA GA | Quencher-1 | WT Probe | ||
| 17268 | Fluorophore-2 | TTC TCT TCT GCA AGC ATC TAA AGA A | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 17262 | 0.40 uM |
| 17263 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.