B6(Cg)-App^em3Aduci/J

Stock number: 040405
Product name: hAbeta-Swe-VI44-45FF-loxP-KI
Research areas: Mouse/Human Gene Homologs, Neurobiology Research

Description

This hAbeta-Swe-VI44-45FF-loxP-KI "humanized" App knock-in strain has 7 missense mutations introduced into exons 16 and 17 of the mouse App gene. Exon 16 is also flanked by loxP sites. This strain may be useful for studying the impact of missense variants in APP on gamma-secretase mediated proteolytic processing and development of late-onset Alzheimer's disease (LOAD) related phenotypes.

Detailed description

This hAbeta-Swe-VI44-45FF-loxP-KI knock-in mouse model of Alzheimer's disease (AD) carries humanizing Aβ region R684H, F681Y, and G676R mutations, and the KM670/671NL (Swedish) mutations in exon 16 present in hAbeta-Swe-loxP-KI mice (Stock No. 039630) which increase cleavage of APP by beta-secretase. This hAbeta-Swe-VI44-45FF-loxP-KI mouse line also has V715F and I716F (Iberian) mutations in exon 17 which are predicted to affect cleavage by gamma-secretase. hAbeta-Swe-VI44-45FF-loxP-KI mice have the V715F and I716F missense variants in exon 17 in cis with the KM670-671NL (Swedish) and humanized Aβ sequence in exon 16. Exon 16 is flanked by loxP sites enabling inactivation of APP synthesis following Cre-recombination. If additional characterization of these mice is performed, we may modify the strain description accordingly.

Both heterozygous and homozygous mice are viable and fertile.

Important note about App isoforms and exon numbering:The App-201 isoform (695 aa protein) is encoded by 16 exons, of which the Abeta sequence is encoded by exon 14. The App-206 isoform (770 aa protein) is encoded by 18 exons, of which the Abeta sequence is encoded by exon 16.

Development

A guide RNA (CACCAGGGTGATGACAATCA) was designed to introduce a GTG to TTC missense mutation at amino acid position 715 and an ATT to TTC missense mutation at amino acid position 716 in exon 17 of the endogenous amyloid beta precursor protein (App) gene present in hAbeta-Swe-loxP-KI mice (Stock No. 039630), resulting in a valine to phenylalanine mutation (V715F) and an isoleucine to phenylalanine mutation (I716F; encoding the Iberian variant). The crRNA, tracrRNA and CAS9 nuclease were complexed to form an RNP, then introduced into the cytoplasm of hAbeta-loxP-KI-derived zygotes with well recognized pronuclei. Surviving embryos were transferred to pseudopregnant females. Progeny were screened by DNA sequencing to identify hAbeta-Swe-VI44-45FF-loxP-KI animals with the V715F and I716F missense variants in exon 17 in cis with the KM670-671NL (Swedish) and humanized Aβ sequence in exon 16. hAbeta-Swe-VI44-45FF-loxP-KI mice were then bred to C57BL/6J mice (Stock No. 000664) for germ line transmission. This colony was backcrossed to C57BL/6J for at least two generations. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Important note about App isoforms and exon numbering:The App-201 isoform (695 aa protein) is encoded by 16 exons, of which the Abeta sequence is encoded by exon 14. The App-206 isoform (770 aa protein) is encoded by 18 exons, of which the Abeta sequence is encoded by exon 16.

Allele

Symbol: App^em3Aduci
Name: endonuclease-mediated mutation 3, Frank LaFerla
MGI accession ID: MGI:8248711
Generation method: Endonuclease-mediated
Attributes: Humanized sequence
Marker symbol: App
Marker name: amyloid beta (A4) precursor protein
Marker synonyms: AAA; Abeta; ABPP; AD1; Adap; alpha-sAPP; APPI; appican; betaAPP; CTFgamma; Cvap; E030013M08Rik; PN2; PN-II; preA4; protease nexin II
Chromosome: 16
Strain of origin: B6(Cg)-App^em1Aduci/J
Molecular note: A guide RNA (CACCAGGGTGATGACAATCA) was designed to introduce a GTG to TTC missense mutation at amino acid position 715 and an ATT to TTC missense mutation at amino acid position 716 in exon 17 of the endogenous amyloid beta precursor protein (App) gene in App^em3Aduci.