B6;129S-Gt(ROSA)26Sor^{tm66.1(CAG-tdTomato)Hze} Cd69^{em1(cre/ERT2)Parsa}/ParsaJ

Stock number: 042130
Product name: Cd69-CreERT²
Research areas: Research Tools

Description

Cd69-CreERT² knock-in mice have a tamoxifen-inducible cre/ERT2 sequence replacing the stop codon of exon 5 of the Cd69 gene. They also contain the Ai66 dual Dre/Cre recombinase fluorescent reporter allele (from Stock No. 021876). These mice may be useful for deleting floxed sequences in activated T cells. Combining this mouse line with Sell-DreERT² Ai66 mice (Stock No. 042129) creates Tracking Recently Activated Cell Kinetics (TRACK) mice, a dual-recombinase fate-mapping system that enables the spatial and temporal labeling of recently activated CD4⁺ T cells allowing the analysis of pathogen-specific responses.

Detailed description

Cd69-CreERT² knock-in mice have a P2A sequence fused to a tamoxifen-inducible cre/ERT2 sequence inserted downstream of the last exon, exon 5, of the CD69 antigen (Cd69) gene. The expression of endogenous Cd69 is not affected by the insertion of the cre/ERT2 sequence. Cd69 encodes CD62L, a type II transmembrane C-type lectin receptor that is rapidly induced on activated immune cells and acts as a modulator of immune homeostasis. CD62L, encoded by the Sell gene, is expressed on naive T cells which lack the lack the activation marker CD69. Upon activation, naive T cells rapidly upregulate CD69 on the cell surface, resulting in the transient co-expression of CD62L and CD69, followed by the downregulation of both Sell and Cd69.

This mouse line also contains the Ai66 dual Dre/Cre recombinase fluorescent reporter allele (from Stock No. 021876). Restricted to the cytoplasm, cre/ERT2 can only gain access to the nuclear compartment after exposure to tamoxifen. Tamoxifen-inducible, Cre-mediated recombination will result in deletion of the floxed sequences in the Cre-expressing cells of the offspring. The donating investigator reports no Cre activity prior to tamoxifen administration.

Further breeding to Sell-DreERT² Ai66 mice (Stock No. 042129) results in the creation of Tracking Recently Activated Cell Kinetics (TRACK) mice (Stock No. 042128). TRACK mice are a dual-recombinase fate-mapping system that enables the spatial and temporal labeling of recently activated T cells.



The donating investigator reports that double homozygous Cd69-CreERT² Ai66 mice are viable and fertile and exhibit decreased expression of CD69 on T cells as compared to wildtype mice.

Development

A sgRNA (AGCAAGCCCTCCAGATGACG) was designed to replace the stop codon in the last exon, exon 5, of the CD69 antigen (Cd69) gene (based on Cd69-201 ENSMUST00000032259.6) with a P2A sequence fused to a tamoxifen-inducible cre/ERT2 fusion gene sequence. sgRNA, target vector plasmid, and the Cas9 protein were electroporated into the cytoplasm of embryos derived from C57BL/6J mice. Targeted embryos were transferred to pseudopregnant females. Correctly targeted pups were identified by PCR and resulting Cd69-CreERT² knock-in mice were backcrossed to C57BL/6J mice (Stock No. 000664) for at least 3 generations by the donating laboratory to remove off-target CRISPR sites. Mice were subsequently bred to Ai66 mice (Stock No. 021876) before being sent to The Jackson Laboratory. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Cd69^{em1(cre/ERT2)Parsa}
Name: endonuclease-mediated mutation 1, Roham Parsa
MGI accession ID: MGI:8460360
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing; Inducible
Synonyms: Cd69-CreERT2
Marker symbol: Cd69
Marker name: CD69 antigen
Marker synonyms: 5830438K24Rik; AIM; BL-AC/P26; CLEC2C; EA1; GP32/28; MLR-3; VEA
Chromosome: 6
Strain of origin: C57BL/6J
Molecular note: A sgRNA (AGCAAGCCCTCCAGATGACG) was designed to replace the stop codon in the last exon, exon 5, of the CD69 antigen (Cd69) gene with a P2A sequence fused to a tamoxifen-inducible cre/ERT2 fusion gene sequence.

Allele

Symbol: Gt(ROSA)26Sor^{tm66.1(CAG-tdTomato)Hze}
Name: targeted mutation 66.1, Hongkui Zeng
MGI accession ID: MGI:3809505
Generation method: Targeted
Attributes: Conditional ready (e.g. floxed); No functional change
Synonyms: Ai66(RCRL-tdT); Ai66(RCRL-tdT)deltaNeo; Ai66(Rosa-CAG-RoxSTOPRox-LoxSTOPLox-tdTomato); Ai66D; Ai66deltaNeo; Gt(ROSA)26Sor^{tm66.1(CAG-rstpr-xstpx-tdTomato)Hze}; R26R-rox-tdTomato
Marker symbol: Gt(ROSA)26Sor
Marker name: gene trap ROSA 26, Philippe Soriano
Marker synonyms: beta geo; Gtrgeo26; Gtrosa26; R26; ROSA26; SETD5-AS1; Thumpd3as1
Chromosome: 6
Strain of origin: (129S6/SvEvTac x C57BL/6NCrl)F1
Site of expression: Expression of tdTomato fluorescence depends upon promoter used that drives both FLP and Cre recombinase.
Molecular note: The Rosa-pCAG-RSR-LSL-tdTomato-WPRE-bGHpA-AttB-PGK-Neo-polyA-AttP targeting vector was designed with (from 5' to 3') a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (from pCAGGS), an Rox-flanked STOP cassette (with a short open reading frame, followed by translational stops in all three reading frames, a synthetic polyA sequence, a polyA sequence from the human growth hormone gene, and a polyA sequence from the Herpes Simplex Virus TK gene), a loxP-flanked STOP cassette (with stop codons in all three reading frames linked to three repeats of the SV40 polyA signal), a sequence encoding the tdTomato fluorescent protein (a non-oligomerizing DsRed fluorescent protein variant with a 12 residue linker fusing two copies of the protein (tandem dimer)), a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE; to enhance the mRNA transcript stability), a bovine growth hormone polyA signal, an AttB site, a PGK promoter-Neomycin resistance gene-PGK polyA cassette, and an AttP site. PhiC31-mediated recombination removed the AttB/AttP-flanked PGK-Neo-polyA cassette and replace it with the recombined AttB/AttP site (AttL).