C57BL/6J-Dmp1^{em1(cre/ERT2)Yy}/J

Stock number: 042044
Product name: Dmp1^em1(CreERT2)
Research areas: Internal/Organ Research, Research Tools

Description

Dmp1^em1(CreERT2) knock-in mice have a tamoxifen-inducible cre/ERT2 sequence inserted upstream of the 3' UTR of the Dmp1 gene. These mice may be useful for studying the role of DMP1 in cortical and trabecular osteocytes.

Detailed description

Dmp1^em1(CreERT2) knock-in mice have an IRES sequence fused to a tamoxifen-inducible cre/ERT2 sequence inserted upstream of the 3' UTR of the endogenous dentin matrix protein 1 (Dmp1) gene. Dmp1 encodes a non-collagenous extracellular matrix protein that is critical for proper bone mineralization, osteocyte maturation, and phosphate homeostasis. Loss-of-function mutations in DMP1 cause autosomal recessive hypophosphatemic rickets. The expression of endogenous Dmp1 is not affected by the insertion of the cre/ERT2 sequence. Restricted to the cytoplasm, cre/ERT2 can only gain access to the nuclear compartment after exposure to tamoxifen. When these Dmp1^em1(CreERT2) mice are bred with mice containing loxP-flanked sequences, tamoxifen-inducible, Cre-mediated recombination will result in deletion of the floxed sequences in the Cre-expressing cells of the offspring.

Homozygous mice are viable and fertile. Highly efficient tamoxifen-inducible recombination is evident in over 90% of cortical and trabecular osteocytes with minimal off-target expression in non-bone tissues. The donating investigator reports some Cre activity prior to tamoxifen administration. Specifically, expression is detected in less than 10% of osteocytes before P7 in the cortical bone and before P21 in the trabecular bone. At P60, reaching young adulthood, expression is detected in 35.6 ± 2.6% of osteocytes in the cortical bone and 25.5 ± 3.9% in the trabecular bone.

The donating investigator also made a Dmp1^em2(ZsGreen) knock-in mouse line that is available as Stock No. 042045. The Dmp1^em1(CreERT2) and Dmp1^em2(ZsGreen) lines are complementary tools that provide both an inducible Cre-driver line for temporally controlled osteocyte-specific genetic manipulation and a faithful reporter line for mapping the spatial and temporal dynamics of endogenous Dmp1 expression.

Of note, The Jackson Laboratory distributes a transgenic cre-ERT2 expressing mouse line a Stock No. 032757. The donating investigator for Stock No. 032757 reports that when combined with Ai9 mice (Stock No. 007909), progeny exhibit some leakiness in about 20% of osteocytes prior to tamoxifen administration.

Development

A sgRNA (CCAAGATGACAATGACTGTC) was designed to target sequence between the stop codon and 3'UTR of the endogenous dentin matrix protein 1 (Dmp1) gene (based on Dmp1:ENSMUST00000066708.6) for insertion of an IRES fused to a tamoxifen-inducible cre/ERT2 fusion gene sequence. sgRNA, a repair template, and the Cas9 RNA were electroporated into the cytoplasm of embryos derived from C57BL/6J mice. Targeted embryos were transferred to pseudopregnant females. Correctly targeted pups were identified by PCR and Sanger sequencing, and resulting Dmp1^em1(CreERT2) knock-in mice were bred to C57BL/6J mice (Stock No. 000664) for at least three generations by the donating lab to remove off-target CRISPR sites. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Dmp1^{em1(cre/ERT2)Yy}
Name: endonuclease-mediated mutation 1, Yingzi Yang
MGI accession ID: MGI:8409861
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing; Inducible
Synonyms: Dmp1^{em1(cre/ERT2)}
Marker symbol: Dmp1
Marker name: dentin matrix protein 1
Marker synonyms: AG1; ARHP; ARHR; DENTMAT; DMP-1
Chromosome: 5
Strain of origin: C57BL/6J
Molecular note: Using CRISPR/Cas9 technology, an sgRNA (CCAAGATGACAATGACTGTC) was designed to target the sequence between the stop codon and 3'UTR of the endogenous dentin matrix protein 1 (Dmp1) gene (based on Dmp1:ENSMUST00000066708.6) for insertion of an IRES fused to a tamoxifen-inducible cre/ERT2 fusion gene sequence.