NOD/ShiLtJ-Tnfrsf9^em4Ygch/J

Stock number: 041960
Product name: Tnfrsf9^fl
Research areas: Diabetes and Obesity Research, Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

Tnfrsf9^fl/fl floxed mice have exon 2 of the Tnfrsf9 gene floxed. Male and female mice develop spontaneous type 1 diabetes (T1D) similar to NOD/ShiLtJ mice.

Detailed description

Tnfrsf9^fl/fl floxed mice have exon 2 of the Tnfrsf9 gene floxed. Tnfrsf9 encodes CD137, that, along with its ligand, CD137L, is involved in the interaction between antigen presentation cells and T cells. Mice that are homozygous for this allele are viable and fertile. Male and female mice develop spontaneous type 1 diabetes (T1D) similar to NOD/ShiLtJ mice.

Mice were further bred to NOD.Foxp3-cre mice (Stock No. 008694) to generate Treg-specific knock-out of CD137. The expression of CD137 in conventional CD4 and CD8 T cells is not significantly impacted. Resulting Cre⁺-Tnfrsf9^fl/fl mice have similar levels of Foxp3⁺ Tregs in the thymus, spleen, and pancreatic lymph node when compared to wildtype Cre⁺-Tnfrsf9^+/+ mice. Serum soluble CD137 is reduced by 70% in Cre⁺-Tnfrsf9^fl/fl mice compared to control Cre⁺-Tnfrsf9^+/+. Cre⁺-Tnfrsf9^fl/fl mice develop diabetes more rapidly with higher levels of insulitis in both sexes than the wild-type littermates.

Development

sgRNAs (CACTCCGGGTATCTGCACAC, CAGTGTGCAGATACCCGGAG, TCCCTTGCAAAAGCTTGTTG, CCTTGCAAAAGCTTGTTGAG, and CCCCTCAACAAGCTTTTGCA) were used to insert loxP sites flanking exon 2 of the tumor necrosis factor receptor superfamily, member 9 (Tnfrsf9) gene. sgRNAs, Cas9 nuclease mRNA, and donor DNA were introduced into the cytoplasm of zygotes derived from NOD/ShiLtJ mice (Stock No. 001976) with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. Tnfrsf9^fl/fl pups were identified by sequencing and PCR and further backcrossed to NOD/ShiLtJ mice for at least 2 generations. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize NOD/ShiLtJ oocytes.

Allele

Symbol: Tnfrsf9^em4Ygch
Name: endonuclease-mediated mutation 4, Yi-Guang Chen
MGI accession ID: MGI:8393352
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed)
Synonyms: Tnfrsf9^fl
Marker symbol: Tnfrsf9
Marker name: tumor necrosis factor receptor superfamily, member 9
Marker synonyms: 4-1BB; A930040I11Rik; CD137; CDw137; ILA; IMD109; Ly63
Chromosome: 4
Strain of origin: NOD/ShiLtJ
Molecular note: Using the CRISPR/Cas9 system, sgRNAs (CACTCCGGGTATCTGCACAC, CAGTGTGCAGATACCCGGAG, TCCCTTGCAAAAGCTTGTTG, CCTTGCAAAAGCTTGTTGAG, and CCCCTCAACAAGCTTTTGCA) were used to insert loxP sites flanking exon 2 of the tumor necrosis factor receptor superfamily, member 9 (Tnfrsf9) gene directly in NOD embryos.