C57BL/6N-Cdkn1a^{em1(cre/ERT2)Hmeh}/J

Stock number: 041889
Product name: Cdkn1a^CreERT2
Strain synonyms: p21-CreERT2
Research areas: Cancer Research, Cell Biology Research, Neurobiology Research, Research Tools

Description

The Cdkn1a^CreERT2 knock-in mice have a cre/ERT2 sequence followed by P2A peptide inserted into the N-terminal of the cyclin dependent kinase inhibitor 1A (Cdkn1a). The line allows for tamoxifen-inducible activation of Cre recombinase in all cells expressing Cdkn1a. This is useful for studies of cellular senescence and cell cycle biology.

Detailed description

The Cdkn1a^CreERT2 knock-in mice have a bicistronic CreERT2 coding region fused to the P2A peptide immediately downstream of the endogenous cyclin-dependent kinase inhibitor 1A (Cdkn1a) gene promoter and upstream of the coding sequence. Cdkn1a codes for p21 (also known as p21Cip1, p21WAF), which is expressed during development in cells involved with cell-cycle arrest, lysosomal dysfunction, and a senescence-associated secretory phenotype (SASP). The homozygous mice are viable and fertile. When Cdkn1a^CreERT2 mice are bred with mice containing loxP-flanked sequences, tamoxifen-inducible Cre-mediated recombination will result in the deletion of the floxed sequences in all cells expressing Cdkn1a, for example, in damaged cells or in senescent cells.

Crossing these mice to a Rosa26^{loxp-stop-loxp-tdTomato}, also known as Ai9, mouse line (Stock No. 007909), and when pregnant dams were administered tamoxifen during the gestational period, positive labeling was seen in specialized brain cell types during neurodevelopment in embryonic day (E) 13.5 mouse embryos. The donating investigator reported that no tdT expression was observed without tamoxifen induction. These Cdkn1a^CreERT2 mice may be useful for studying developmentally programmed p21⁺ senescent cells during development.

Development

A DNA sequence containing Cre/ERT2 followed by P2A was inserted immediately downstream of the Cdkn1a promoter and upstream of the coding sequence using CRISPR/Cas9 technology (Reference transcript: ENSMUST00000023829.9 Cdkn1a-201). The donor template and Cas9 protein complexed with single guide RNA (sgRNA, 'GACATCACCAGGATTGGACA') were injected into pronuclear-stage embryos (C57BL/6NHsd), then implanted into a foster female. One founder with correct homologous recombination containing the Cre sequence was selected and mated with C57BL/6NHsd wild-type mice to establish the Cdkn1a^CreERT2 knock-in mouse line. The heterozygous mice were then intercrossed to create a homozygous Cdkn1a^CreERT2 knock-in mouse line and maintained by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm were cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6NJ (Stock No. 005304) oocytes.

Allele

Symbol: Cdkn1a^{em1(cre/ERT2)Hmeh}
Name: endonuclease-mediated mutation 1, Hiruy S Meharena
MGI accession ID: MGI:8354833
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing; Inducible
Synonyms: Cdkn1a^CreERT2
Marker symbol: Cdkn1a
Marker name: cyclin-dependent kinase inhibitor 1A (P21)
Marker synonyms: CAP20; CDKI; Cdkn1; CIP1; mda6; MDA-6; P21; p21^WAF1/CIP1; p21Cip1; p21WAF; SDI1; UV96; Waf1
Chromosome: 17
Strain of origin: C57BL/6NHsd
Molecular note: Using CRISPR/Cas9 technology, a CreER and 2PA sequence was inserted immediately downstream of the Cdkn1a promoter and upstream of the coding sequence. A sgRNA (5'-GACATCACCAGGATTGGACA-3') was used.