C57BL/6J-Ptprg^{em2(PTPRG/Aquamarine)Wbrn}/J

Stock number: 041865
Product name: RPTPγ-Aquamarine
Research areas: Mouse/Human Gene Homologs, Neurobiology Research, Research Tools

Description

RPTPγ-Aquamarine knock-in mice have human PTPRG cDNA fused with a C-terminal Aquamarine fluorescent protein replacing the ATG start codon and partial upstream sequence in exon 1 of the endogenous Ptprg gene. The humanized, Aquamarine-tagged receptor is expressed under the control of the endogenous Ptprg regulatory elements. These mice may be useful for studies of acid-base and renal physiology, cardiovascular and cerebrovascular biology, developmental neuroscience, cancer biology, and quantitative FRET imaging.

Detailed description

RPTPγ-Aquamarine knock-in mice have human PTPRG cDNA fused with a C-terminal Aquamarine fluorescent protein replacing the ATG start codon and partial upstream sequence in exon 1 of the endogenous Ptprg gene. The humanized, Aquamarine-tagged receptor is expressed under the control of the endogenous Ptprg regulatory elements. Ptprg encodes a transmembrane signaling molecule whose extracellular carbonic-anhydrase-like domain (CALD) plays a vital role in the development and functioning of the central nervous system (CNS) and has been implicated in tumor suppression, neurodegeneration, and carbon dioxide (CO₂) and bicarbonate (HCO₃^-) sensing.

The insertion of the human PTPRG ORF is useful when studying the disease-associated PTPRG variants relevant to stroke, hypertension, neurodevelopmental and neuroinflammatory disorders, and cancer. Together with RPTPγ-Citrine knock-in mice (Stock No. 041864) this strain can be used in studies spanning acid-base and renal physiology, cardiovascular and cerebrovascular biology, developmental neuroscience, cancer biology, and quantitative FRET imaging.

Homozygous mice are viable and fertile. They exhibit minor behavioral changes including specific motor deficits, reduced latency to react in the tail flick test, enhanced sensory processing for acoustic stimuli, and reduced performance with cued fear conditioning.

The donating laboratory has made two humanized PTPRG, fluorescent reporter-tagged knock-in strains available:
RPTPγ-Citrine knock-in mice (Stock No. 041864)
RPTPγ-Aquamarine knock-in mice (Stock No. 041865)

Development

The RPTPγ-Aquamarine donor vector was designed to replace the ATG start codon and partial upstream sequence in exon 1 of the endogenous protein tyrosine phosphatase receptor type G (Ptprg) gene with the human PTPRG open reading frame (ORF) cDNA fused with a C-terminal Aquamarine cyan fluorescent protein sequence and a SV40pA cassette. Cas9 mRNA, gRNA (GTGCGTTTTCGGACATGCGGAGG), and the donor vector were injected into fertilized C57BL/6J oocytes and embryos were transferred to pseudopregnant females. Correctly targeted RPTPγ-Aquamarine pups were identified by PCR and sequencing and were further backcrossed to C57BL/6J inbred mice (Stock No. 000664) to remove potential off-target CRISPR sites. Upon arrival, sperm was cryopreserved. To establish a live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Ptprg^{em2(PTPRG/Aquamarine)Wbrn}
Name: endonuclease-mediated mutation 2, Walter Boron
MGI accession ID: MGI:8386637
Generation method: Endonuclease-mediated
Attributes: Reporter; Null/Knockout; Inserted expressed sequence; Humanized sequence
Marker symbol: Ptprg
Marker name: protein tyrosine phosphatase, receptor type, G
Marker synonyms: 5430405N12Rik; HPTPG; Ptpg; RPTPG; RPTPgamma; R-PTP-GAMMA
Chromosome: 14
Strain of origin: C57BL/6J
Molecular note: A donor vector and gRNA (GTGCGTTTTCGGACATGCGGAGG) were designed to replace the ATG start codon and partial upstream sequence in exon 1 of the endogenous protein tyrosine phosphatase receptor type G (Ptprg) gene with the human PTPRG open reading frame (ORF) cDNA fused with a C-terminal Aquamarine cyan fluorescent protein sequence and a SV40pA cassette.