B6.Cg-Acan^em1(cre)Jkeb/J

Stock number: 041857
Product name: Acan-P2A-Cre
Research areas: Neurobiology Research, Research Tools

Description

Acan-Cre knock-in mice are designed to have P2A-cre sequence inserted immediately before the stop codon of the aggrecan gene. The endogenous promoter directs expression of Cre recombinase to Class B excitatory neurons in the adult cerebellar nuclei.

Detailed description

Acan-Cre knock-in mice are designed to have P2A-cre sequence inserted immediately before the stop codon of the aggrecan (Acan) gene. Acan encodes an extracellular matrix protein expressed in the growth plate and articular cartilage, and fibrocartilage of the meniscus, trachea, and intervertebral disks. Mutations in Acan have been linked to skeletal disorders, ranging from short stature to severe chondrodyplasias. Acan is also expressed in the brain. The presence of P2A-cre cassette allows for expression of Acan and cre. Heterozygous mice are viable and fertile. The donating investigator reports that some homozygous animals can have a dwarf phenotype. When these mice are bred with mice containing loxP-flanked sequences, Cre-mediated recombination will result in deletion of the loxP-flanked sequences in Acan expressing cells, including Class B excitatory neurons in the adult cerebellar nuclei. These class B neurons are large glutamatergic neurons that are vulnerable in neurodegenerative conditions such as Friedreich's Ataxia.

Development

A guide RNA (CCCCAGCATGGCCCACTGAG) was used to target sequences immediately before the stop codon of the aggrecan (Acan) gene for insertion of a porcine teschovirus-1 2A oligopeptide (P2A) self-cleaving peptide, to mediate ribosomal skipping, fused to a Cre recombinase sequence (cre). Guide RNA, a donor DNA, and the Cas9 nuclease were introduced into the cytoplasm of fertilized eggs with well recognized pronuclei from B6SJL mice. Embryos were transferred to pseudopregnant females. Correctly targeted Acan-Cre pups were identified by PCR and were further bred to C57BL/6J mice (Stock No. 000664) for at least 5 generations to remove off-target sites. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Acan^em1(cre)Jkeb
Name: endonuclease-mediated mutation 1, Justus M Kebschull
MGI accession ID: MGI:8395644
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing
Synonyms: Acan-Cre
Marker symbol: Acan
Marker name: aggrecan
Marker synonyms: Agc; Agc1; AGCAN; b2b183Clo; CSPG1; CSPGCP; MSK16; SEDK; SSOAOD
Chromosome: 7
Strain of origin: C57BL/6 x SJL
Molecular note: Using CRISPR technology, a guide RNA (CCCCAGCATGGCCCACTGAG) was used to target sequences immediately before the stop codon of the aggrecan (Acan) gene for insertion of a porcine teschovirus-1 2A oligopeptide (P2A) self-cleaving peptide, to mediate ribosomal skipping, fused to a Cre recombinase sequence (cre).