B6;D2-Rel^em2Msung/J

Stock number: 041817
Product name: mScarlet-c-Rel
Research areas: Cancer Research, Cell Biology Research, Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

mScarlet-c-Rel knock-in (KI) mice express an mScarlet/c-Rel fusion gene, as well as having loxP sites flanking the endogenous Rel promoter region. After Cre-mediated recombination, Rel will be deleted in cre-expressing cells and tissues. These mice may be a useful tool for visualizing NF-κB activity in various immune and inflammatory response pathways.

Of note, the donating laboratory has also made an mEGFP-c-Rel knock-in mouse line available as Stock No. 041816.

Detailed description

Rel (reticuloendotheliosis oncogene or c-Rel) is a member of the NF-kappaB/Rel transcription factor family predominantly expressed in cells of the immune system. It is involved in the expression of genes controlling cell growth, survival, proliferation, immune response, apoptosis as well as those playing a role in the regulation of multiple autoimmune and inflammatory diseases and cancer. c-Rel is also suggested to act as an oncogene in multiple cancers. mScarlet-c-Rel knock-in (KI) mice have a monomeric red fluorescent protein (mScarlet) gene inserted in-frame immediately downstream of the start codon of the Rel gene, resulting in expression of an mScarlet/c-Rel fusion gene. The allele also contains loxP sites flanking the endogenous Rel promoter region and mScarlet sequence, allowing for Cre-inducible deletion of Rel in cre-expressing cells and tissues.

Heterozygous and homozygous mice are viable and fertile with no overt phenotype. mScarlet is detectable by flow cytometry or microscopy. After Cre-mediated recombination, the mScarlet/c-Rel fusion gene is expected to be deleted in cre-expressing cells and tissues. These mice may be a useful tool for visualizing NF-κB activity in various immune and inflammatory response pathways.

Of note, the donating laboratory has also made an mEGFP-c-Rel knock-in mouse line available as Stock No. 041816.

Development

The mScarlet-c-Rel knock-in (KI) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs ("c-Rel sgRNA#1 (antisense)" CCGGTACTCACTCGAGGCCA (PAM = TGG) and "c-Rel sgRNA#2 (antisense)" ACTCACTCGAGGCCATGGCT (PAM = CGG)) were used to insert a cassette containing an initial loxP site, the Rel proto-oncogene, NFKB subunit (Rel) promoter sequence, and a monomeric red fluorescent protein (mScarlet) sequence, immediately after the start codon of the Rela proto-oncogene, as well as a second loxP in the first intron of the Rel gene on chromosome 11. As the loxP flanked region also contains the Rel promoter sequence, this allows for generation of a Cre-inducible knock-out. The sgRNAs, donor plasmid and Cas9 nuclease were introduced into zygotes derived from C57BL/6Ncr mice crossed to B6D2F1/J mice. The resulting mScarlet-c-Rel KI mice were backcrossed to C57BL/6J mice for at least 2 generations by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J (Stock No. 000664) oocytes.

Allele

Symbol: Rel^em2Msung
Name: endonuclease-mediated mutation 2, Myong-Hee Sung
MGI accession ID: MGI:8385526
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Reporter
Synonyms: mScarlet-c-Rel
Marker symbol: Rel
Marker name: reticuloendotheliosis oncogene
Marker synonyms: c-Rel; HIVEN86A; IMD92
Chromosome: 11
Strain of origin: B6D2F1
Molecular note: Using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs ("c-Rel sgRNA#1 (antisense)" CCGGTACTCACTCGAGGCCA (PAM = TGG) and "c-Rel sgRNA#2 (antisense)" ACTCACTCGAGGCCATGGCT (PAM = CGG)) were used to insert a cassette containing an initial loxP site, the Rel proto-oncogene, NFKB subunit (Rel) promoter sequence, and a monomeric red fluorescent protein (mScarlet) sequence, immediately after the start codon of the Rela proto-oncogene, as well as a second loxP in the first intron of the Rel gene on chromosome 11. As the loxP flanked region also contains the Rel promoter sequence, this allows for generation of a Cre-inducible knock-out.