B6;D2-Rela^em1Msung/J

Stock number: 041815
Product name: mScarlet-RelA
Research areas: Cancer Research, Cell Biology Research, Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

mScarlet-RelA knock-in (KI) mice express a mScarlet/Rela fusion gene, as well as having loxP sites flanking the endogenous Rela promoter region. After Cre-mediated recombination, Rela will be deleted in cre-expressing cells and tissues. These mice may be a useful tool for visualizing NF-κB activity in various immune and inflammatory response pathways.

Of note, the donating laboratory has also made an mEGFP-RelA knock-in mouse line available as Stock No. 041814.

Detailed description

The v-rel reticuloendotheliosis viral oncogene homolog A (avian), or Rela, gene encodes a member of the Rel/NF-κB family of transcription factors which regulate responses to inflammation and cellular stresses. mScarlet-RelA knock-in (KI) mice have a monomeric red fluorescent protein (mScarlet) gene inserted in-frame immediately downstream of the start codon of the Rela gene, resulting in expression of an mScarlet/Rela fusion gene. The allele also contains loxP sites flanking the endogenous Rela promoter region and mScarlet sequence, allowing for Cre-inducible deletion of Rela in cre-expressing cells and tissues.

Heterozygous and homozygous mice are viable and fertile with no overt phenotype. mScarlet is detectable by flow cytometry and microscopy. After Cre-mediated recombination, the mScarlet/Rela fusion gene is expected to be deleted in cre-expressing cells and tissues. These mice may be a useful tool for visualizing NF-κB activity in various immune and inflammatory response pathways.

Of note, the donating laboratory has also made an mEGFP-RelA knock-in mouse line available as Stock No. 041814.

Development

The mScarlet-RelA knock-in (KI) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs (“mScarlet-Rela sgRNA#1 (sense)” GACCCTGACCATGGACGGTG (PAM = AGG) and "mScarlet-Rela sgRNA#2 (antisense)" GAGGGCAGCCTCACCGTCCA (PAM = TGG)) were used to insert a cassette containing an initial loxP site, the Rela proto-oncogene, NFKB subunit (Rela) promoter sequence, and a monomeric red fluorescent protein (mScarlet) sequence immediately after the start codon of the Rela proto-oncogene, as well as a second loxP in the first intron of the Rela gene on chromosome 19. As the loxP flanked region also contains the Rela promoter sequence, this allows for generation of a Cre-inducible knock-out. Rela transcript Rela-201 (ENSMUST00000025867.7) was used as reference for exon number and sequence. The sgRNAs, donor plasmid and Cas9 nuclease were introduced into zygotes derived from C57BL/6Ncr mice crossed to B6D2F1/J mice. The resulting mEGFP-RelA KI mice were backcrossed to C57BL/6J mice for at least 2 generations by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J (Stock No. 000664) oocytes.

Allele

Symbol: Rela^em1Msung
Name: endonuclease-mediated mutation 1, Myong-Hee Sung
MGI accession ID: MGI:8385520
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Reporter
Synonyms: mScarlet-RelA
Marker symbol: Rela
Marker name: v-rel reticuloendotheliosis viral oncogene homolog A (avian)
Marker synonyms: AIF3BL3; CMCU; NFkB; NFKB3; nos2; p65; p65 NF kappaB
Chromosome: 19
Strain of origin: B6D2F1
Molecular note: Using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs (“mScarlet-Rela sgRNA#1 (sense)” GACCCTGACCATGGACGGTG (PAM = AGG) and "mScarlet-Rela sgRNA#2 (antisense)" GAGGGCAGCCTCACCGTCCA (PAM = TGG)) were used to insert a cassette containing an initial loxP site, the Rela proto-oncogene, NFKB subunit (Rela) promoter sequence, and a monomeric red fluorescent protein (mScarlet) sequence immediately after the start codon of the Rela proto-oncogene, as well as a second loxP in the first intron of the Rela gene on chromosome 19. As the loxP flanked region also contains the Rela promoter sequence, this allows for generation of a Cre-inducible knock-out.