C57BL/6-Gt(ROSA)26Sor^{em2(CAG-Gnaq*R183Q,-GFP)Psmi}/J

Stock number: 041810
Product name: R26^GT-Gnaq-GFP
Research areas: Developmental Biology Research, Mouse/Human Gene Homologs, Research Tools

Description

R26^GT-Gnaq-GFP mice express an activating mutant Gnaq*R183Q and GFP after removal of a loxP-flanked STOP cassette. Gnaq*R183Q is the most common mutation found in patients with capillary malformation (CM). This reporter strain is a valuable tool for the preclinical testing of CM pharmacotherapy.

Detailed description

R26^GT-Gnaq-GFP mice express an activating mutant Gnaq*R183Q and GFP after removal of a loxP-flanked STOP cassette. Gnaq*R183Q is the most common mutation found in patients with capillary malformation (CM), a congenital, non-hereditary lesion composed of enlarged and tortuous blood vessels. Homozygous and heterozygous mice are viable and fertile prior to cre-expression. In the presence of Cre, the floxed stop cassette is excised, allowing for the independent expression of Gnaq*R183Q and GFP in Cre-expressing cells.

When R26^GT-Gnaq-GFP females are bred to Cdh5-cre males (Stock No. 006137), Cre expression in endothelial cells (ECs) results in a severe vascular phenotype, including enlarged blood vessels and occasional hemorrhage, with lethality by embryonic day 16.5 (E16.5).

When R26^GT-Gnaq-GFP females are bred to Cdh5^CreER males with tamoxifen-inducible endothelial Cre expression, induction of Gnaq*R183Q expression in ECs at postnatal day 1 (P1) results in vessel abnormalities including vessel bulging and abnormal vessel tortuosity, most noticeable in skeletal muscles and the gastrointestinal tract.

In the presence of Cre, GFP is detectable by direct fluorescence and immunofluorescence. The donating investigator reports low level expression of Gnaq*R183Q (5.75% of Gnaq transcripts) prior to Cre expression that did not produce vascular or other anomalies.

Development

The R26^GT-Gnaq-GFP targeting vector is composed of (from 5' to 3') a splice acceptor (SA), a floxed STOP cassette, a mutant guanine nucleotide binding protein, alpha q polypeptide (Gnaq) cDNA, an internal ribosome entry sequence (IRES), and a GFP sequence under control of the chicken beta-actin (CAG) promoter introduced to the Gt(ROSA)26Sor locus. The Gnaq cDNA contains a guanine to adenine base change that results in an arginine to glutamine mutation at amino acid 183 (R183Q), homologous to the most common mutation found in patients with capillary malformation (CM). The floxed STOP codon is composed of neomycin and kanamycin resistance sequences. The IRES sequence allows for independent expression of Gnaq*R183Q and GFP.

Cas9 protein, gRNA (ACTCCAGTCTTTCTAGAAGATGG), and a donor vector were injected into fertilized C57BL/6NHsd oocytes and embryos were transferred to pseudopregnant CD-1 females. Correctly targeted R26^GT-Gnaq-GFP pups were identified by PCR and were further backcrossed to C57BL/6J inbred mice (Stock No. 000664) for at least 7 generations by the donating laboratory. Upon arrival, sperm was cryopreserved. To establish a live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Gt(ROSA)26Sor^{em2(CAG-Gnaq*R183Q,-GFP)Psmi}
Name: endonuclease-mediated mutation 2, Patrick Smits
MGI accession ID: MGI:8270884
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Reporter; Inserted expressed sequence
Synonyms: Gt(ROSA)26Sor^{em2(CAG-Gnaq*R183Q/GFP)Psmi}; R26^GT-Gnaq-GFP
Marker symbol: Gt(ROSA)26Sor
Marker name: gene trap ROSA 26, Philippe Soriano
Marker synonyms: beta geo; Gtrgeo26; Gtrosa26; R26; ROSA26; SETD5-AS1; Thumpd3as1
Chromosome: 6
Strain of origin: C57BL/6Hsd
Molecular note: The following elements were inserted into an intron: a splice acceptor site, the CAG promoter, a loxP site flanked STOP cassette, modified Gnaq cDNA where arginine codon 183 (CGA) was changed to glutamine (CAA) (p.R183Q), IRES sequence, the GFP reporter gene, and poly(A) signal sequences. This allele only expresses Gnaq and GFP after Cre-mediated deletion of the STOP cassette. The mutation is the equivalent of the same human mutation associated with capillary malformation (CM).