B6J;B6N-Clec7a^{em1(icre/ERT2)Tql}/J

Stock number: 041767
Product name: Clec7a-CreER
Strain synonyms: Clec7a-CreER^T2, Clec7a-P2A-iCreERT2
Research areas: Developmental Biology Research, Neurobiology Research, Research Tools

Description

Clec7a-CreER knock-in mice have a P2A peptide fused to an icre/ERT2 sequence inserted into the C-terminal of the C-type lectin domain family 7, member a (Clec7a) gene. The line allows for tamoxifen-inducible activation of Cre recombinase in all cells expressing Clec7a. This strain may be useful for studying neuroimmune interactions, neurodevelopment, and aging. When combined with Alzheimer's disease mutations, it may be useful for studying neurodegenerative microglia (MGnD) biology.

Detailed description

Clec7a-CreER knock-in mice have a bicistronic P2A-iCreERT2 [consisting of a "self-cleaving" linker (P2A) and a mammalian codon-optimized improved version of Cre recombinase (iCre) fused to a human estrogen receptor ligand-binding domain (ERT2) sequence] inserted immediately upstream of the stop codon of the C-type lectin domain family 7, member a (Clec7a) gene. This is designed to enable tamoxifen-inducible Cre expression in Clec7a-expressing cells while preserving endogenous Clec7a expression. In the central nervous system, iCreERT2 is primarily expressed in Clec7a+ reactive microglia, including disease-associated microglia, with more limited expression in other Clec7a+ myeloid cell populations. Homozygous Clec7a-CreER knock-in mice are viable and fertile, displaying no overt phenotypic abnormalities compared to wildtype mice. These Clec7a-CreER knock-in mice may be useful for studying reactive microglia in neurodegeneration, neurodevelopment, and aging. When combined with Alzheimer's disease mutations, it may be useful for studying neurodegenerative microglia (MGnD) biology.

Development

The gRNA (ATTGTGCAGTAAGCTTTCCT) was designed to target the region between exon 5 and the 3' UTR of the Clec7a gene locus to insert the P2A-Cre/ERT2 sequence immediately before the stop codon of the Clec7a gene (Reference transcript: ENSMUST00000184581.3). The gene targeting vector containing P2A-iCreERT2 and 2 homology arms, left (1009 bp) and right (2094 bp), as a template, and Cas9 mRNA were injected into the cytoplasm of one-cell-stage fertilized eggs collected from C57BL/6NCrl female mice; then transferred to pseudopregnant females. DNA samples from F1 progeny were tested for targeted insertion of P2A-iCreERT2 in the Clec7a gene by Southern blot analysis. This line was crossed to the C57BL/6NCrl mice for 2 generations to eliminate the potential off-target events. Then heterozygous mice were backcrossed to C57BL/6J for at least 2 generations. The heterozygous mice were then intercrossed to produce homozygous Clec7a-CreER mice and maintained on a mixed C57BL/6N and C57BL/6J background by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm were cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J (Stock No. 000664) oocytes.

Allele

Symbol: Clec7a^{em1(icre/ERT2)Tql}
Name: endonuclease-mediated mutation 1, Qingyun Li
MGI accession ID: MGI:8290442
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing; Inducible
Synonyms: Clec7a^{em1(cre)Jkpns}; Clec7a-CreER^T2; Clec7a-P2A-iCreERT2
Marker symbol: Clec7a
Marker name: C-type lectin domain family 7, member a
Marker synonyms: beta-glucan receptor; beta-GR; BGR; CANDF4; CD369; Clec7b; Clecsf12; DECTIN1; dectin-1; RGD1565140; SCARE2
Chromosome: 6
Strain of origin: C57BL/6N
Molecular note: CRISPR/Cas9 genome editing technology was used to insert a cassette containing a 2A-iCreERT2 construct before stop codon in the region between exon 5 and 3’ UTR of the gene.