B6;129-Hopx^{em1(cre/ERT2,-HBEGF)Ttam}/J

Stock number: 041745
Product name: Hopx^FSF-MACD
Research areas: Cancer Research, Research Tools

Description

Hopx^FSF-MACD knock-in mice have a frt-stop-frt-P2A-mScarlet-T2A-Akaluc-P2A-CreERT2-P2A-DTR-WPRE (FSF-MACD) reporter construct inserted in-frame into the stop codon of exon 3 of the Hopx gene. FLP-mediated recombination results in the excision of the STOP sequence, enabling the tissue and time-dependent expression of mScarlet, cre/ERT2, Akaluciferase, and HBEGF. Human HBEGF is expressed in Slc4a11-expressing cells allowing for ablation of these cells following Diphtheria toxin administration. These mice are useful for visualization, isolation, ablation and lineage-tracing alveolar type I (AT1)-like cell state cells.

Detailed description

Hopx^FSF-MACD knock-in mice have a frt-stop-frt-P2A-mScarlet-T2A-Akaluc-P2A-CreERT2-P2A-DTR-WPRE (FSF-MACD) reporter construct inserted in-frame into the stop codon of exon 3 of the HOP homeobox (Hopx) gene. The insertion of the FSF-MACD sequence does not affect endogenous Hopx gene expression.

HOPX is a specific marker of intestinal stem cells and Alveolar Type 1 (AT1) epithelial cells in the lungs. In the absence of FLP recombinase, expression of mScarlet, cre/ERT2, Akaluciferase, and human DTR is prevented by the STOP cassette. After removal of the STOP cassette, mScarlet, cre/ERT2, Akaluciferase, and DTR are expressed. The 2A self-cleaving sequences separating the mScarlet, cre/ERT2, Akaluciferase, and the human diphtheria toxin (DT) receptor (DTR) sequences mediate ribosomal skipping which allows labeling separate cells/tissues. Human DTR is expressed in Hopx-expressing cells allowing for ablation of these cells following diphtheria toxin administration. When mice are further bred with mice containing loxP-flanked sequences, tamoxifen-inducible Cre-mediated recombination will result in deletion of floxed sequences in cre-expressing cells of the offspring. The donating investigator reports no Cre activity prior to tamoxifen administration. mScarlet expression is detected by direct microscopy and flow cytometry.

Homozygous mice are viable and fertile. These mice are useful for visualization, isolation, ablation and lineage-tracing Hopx-expressing cells. When bred to Kras^FSF-G12D mice (Stock No. 023590) and p53^FRT mice (Stock No. 017767), these mice are useful for investigating alveolar type I (AT1)-like cell state cells in cancers.

Development

A crRNA/tracrRNA duplex gRNA (CTGTTACGGACTAGGGAGCC) was designed to target the stop codon of the HOP homeobox (Hopx) gene, within exon 3, (based on Hopx-201 ENSMUST00000120827.9) with a frt-stop-frt-P2A-mScarlet-T2A-Akaluc-P2A-CreERT2-P2A-DTR-WPRE (FSF-MACD) reporter construct. The FRT-flanked STOP cassette is bGlobinpA-(PGK-Hygro-pA)i. The crRNA/tracrRNA, donor sequence, and the Cas9 nuclease protein were transfected into embryonic stem (ES) cells derived from crossing a p53^FRT female mouse (Stock No. 017767) with a Kras^FSF-G12D/+;p53^FRT/FRT male mouse (produced by crossing Stock No. 017767 to Stock No. 023590). Targeted ES cells were microinjected into blastocysts and correctly targeted pups were identified by PCR and sequencing. Resulting Hopx^FSF-MACD knock-in mice were further bred to mice on a mixed B6;129 genetic background for at least 5 generations by the donating lab to remove off-target CRISPR sites and to remove the Kras^FSF-G12D and p53^FRT alleles. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Hopx^{em1(cre/ERT2,-HBEGF)Ttam}
Name: endonuclease-mediated mutation 1, Tuomas Tammela
MGI accession ID: MGI:8347687
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Recombinase-expressing; Reporter; Inducible; Inserted expressed sequence
Synonyms: Hopx^FSF-MACD
Marker symbol: Hopx
Marker name: HOP homeobox
Marker synonyms: 1110018K11Rik; 1200015P04Rik; 2300002F06Rik; Cameo; GIIg15b; HOD; HOP; LAGY; NECC1; OB1; Obl; SMAP31; TOTO
Chromosome: 5
Strain of origin: B6;129
Molecular note: A crRNA/tracrRNA duplex gRNA (CTGTTACGGACTAGGGAGCC) was designed to target the stop codon of the HOP homeobox (Hopx) gene, within exon 3, (based on Hopx-201 ENSMUST00000120827.9) with a frt-stop-frt-P2A-mScarlet-T2A-Akaluc-P2A-CreERT2-P2A-DTR-WPRE (FSF-MACD) reporter construct. The FRT-flanked STOP cassette is bGlobinpA-(PGK-Hygro-pA).
General note: Embryonic stem (ES) cells derived from crossing a p53(FRT) female mouse B6;129-Trp53^tm1.1Dgk/J with a Kras(FSF-G12D/+);p53(FRT/FRT) male mouse (produced by crossing B6;129-Trp53^tm1.1Dgk/J to B6(Cg)-Kras^tm5Tyj/J.