B6;129-Slc4a11^{em1(cre/ERT2,-HBEGF)Ttam}/J

Stock number: 041743
Product name: Slc4a11^FSF-MCD
Research areas: Cancer Research, Research Tools

Description

Slc4a11^FSF-MCD knock-in mice have a frt-stop-frt-P2A-mScarlet-T2A-CreERT2-P2A-DTR-WPRE (FSF-MCD) reporter construct inserted in-frame into the stop codon of exon 21 of the Slc4a11 gene. FLP-mediated recombination results in the excision of the STOP sequence, enabling the tissue and time-dependent expression of mScarlet, cre/ERT2, and DTR. Human DTR is expressed in Slc4a11-expressing cells allowing for ablation of these cells following Diphtheria toxin administration. These mice are useful for visualization, isolation, ablation and lineage-tracing high-plasticity cell state (HPCS) cells.

Detailed description

Slc4a11^FSF-MCD knock-in mice have frt-stop-frt-P2A-mScarlet-T2A-CreERT2-P2A-DTR-WPRE (FSF-MCD) reporter construct inserted in-frame into the stop codon of exon 21 of the solute carrier family 4, sodium bicarbonate transporter-like, member 11 (Slc4a11) gene. The insertion of the FSF-MCD sequence does not affect endogenous Slc4a11 gene expression.

Slc4a11 encodes a sodium-coupled hydroxyl transporter that is highly expressed in corneal endothelial cells, inner ear sensory epithelia, and renal medullary tubules in adults. Expression is induced in subsets of cells in multiple epithelial cancers, including lung, pancreas, colon, and prostate cancers. In the absence of FLP recombinase, expression of mScarlet, cre/ERT2, and DTR is prevented by the STOP cassette. After removal of the STOP cassette, mScarlet, cre/ERT2, and DTR proteins are expressed. The 2A self-cleaving sequences separating the mScarlet, cre/ERT2, and the human diptheria toxin (DT) receptor (DTR) sequences mediate ribosomal skipping which allows labeling separate cells/tissues. Human DTR is expressed in Slc4a11-expressing cells allowing for ablation of these cells following diphtheria toxin administration. When mice are further bred with mice containing loxP-flanked sequences, tamoxifen-inducible Cre-mediated recombination will result in deletion of floxed sequences in cre-expressing cells of the offspring. The donating investigator reports no Cre activity prior to tamoxifen administration. After removal of the STOP cassette, mScarlet is detectable by direct fluorescence microscopy and flow cytometry.

Homozygous mice are viable and fertile. These mice are useful for visualization, isolation, ablation and lineage-tracing targeted cells. When bred to Kras^FSF-G12D mice (Stock No. 023590) and p53^FRT mice (Stock No. 017767), these mice are useful for targeting high-plasticity cell state (HPCS) in cancers which drives progression and therapy resistance.

Development

A crRNA/tracrRNA duplex gRNA (ACATATGGGGAGGTATGAGC) was designed to target the stop codon of the solute carrier family 4, sodium bicarbonate transporter-like, member 11 (Slc4a11) gene, within exon 21, (based on Slc4a11-201 ENSMUST00000099362.11) with a frt-stop-frt-P2A-mScarlet-T2A-CreERT2-P2A-DTR-WPRE (FSF-MCD) reporter construct. The FRT-flanked STOP cassette is bGlobinpA-(PGK-Hygro-pA)i. The crRNA/tracrRNA, donor sequence, and the Cas9 nuclease protein were transfected into embryonic stem (ES) cells derived from crossing a p53^FRT female mouse (Stock No. 017767) with a Kras^FSF-G12D/+;p53^FRT/FRT male mouse (produced by crossing Stock No. 017767 to Stock No. 023590). Targeted ES cells were microinjected into blastocysts and correctly targeted pups were identified by PCR and sequencing. Resulting Slc4a11^FSF-MCD knock-in mice were further bred to mice on a mixed B6;129 genetic background for at least 5 generations by the donating lab to remove off-target CRISPR sites and to remove the Kras^FSF-G12D and p53^FRT alleles. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Slc4a11^{em1(cre/ERT2,-HBEGF)Ttam}
Name: endonuclease-mediated mutation 1, Tuomas Tammela
MGI accession ID: MGI:8347659
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Recombinase-expressing; Inducible; Inserted expressed sequence
Synonyms: Slc4a11^FSF-MCD
Marker symbol: Slc4a11
Marker name: solute carrier family 4, sodium bicarbonate transporter-like, member 11
Marker synonyms: BTR1; CDPD1; CHED; CHED2; dJ794I6.2; NABC1
Chromosome: 2
Strain of origin: B6;129
Molecular note: A crRNA/tracrRNA duplex gRNA (ACATATGGGGAGGTATGAGC) was designed to target the stop codon of the solute carrier family 4, sodium bicarbonate transporter-like, member 11 (Slc4a11) gene, within exon 21, (based on Slc4a11-201 ENSMUST00000099362.11) with a frt-stop-frt-P2A-mScarlet-T2A-CreERT2-P2A-DTR-WPRE (FSF-MCD) reporter construct. The FRT-flanked STOP cassette is bGlobinpA-(PGK-Hygro-pA)i.
General note: Embryonic stem (ES) cells derived from crossing a p53(FRT) female mouse B6;129-Trp53^tm1.1Dgk/J with a Kras(FSF-G12D/+);p53(FRT/FRT) male mouse (produced by crossing B6;129-Trp53^tm1.1Dgk/J to B6(Cg)-Kras^tm5Tyj/J.