B6(Cg)-Itgae^{em1(cre/ERT2)Tber}/J

Stock number: 041736
Product name: Itgae-creER^T2 ; CD103-CreERT2
Research areas: Cancer Research, Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

Itgae-creER^T2 knock-in mice have an IRES-icre/ERT2 inserted between the final coding exon 31 and 3' UTR of the Itgae gene, also referred to as CD103. When these mice are bred with mice containing a loxP-flanked sequence of interest, tamoxifen-inducible, Cre-mediated recombination will result in deletion of the floxed sequences in the Itgae-expressing cells of the offspring. These mice may be useful when studying epithelial immunity.

Detailed description

Itgae (Integrin alpha E, epithelial-associated) codes for CD103, a cell surface glycoprotein that binds to E-cadherin on epithelial cells, tethering immune cells to mucosal barriers of the skin, lung and intestine. CD103 is also a clinical marker for certain blood cancers such as hairy cell leukemia. Itgae-creER^T2 knock-in mice have an IRES-icre-ERT2 inserted between the final coding exon 31 and 3' UTR of the Itgae gene.

Heterozygous and homozygous mice are viable and fertile wit no overt phenotype. When these mice are bred with mice containing a loxP-flanked sequence of interest, tamoxifen-inducible, Cre-mediated recombination will result in deletion of the floxed sequences in the Itgae-expressing cells of the offspring. The donating laboratory bred these Itgae-creER^T2 mice to an Ai14(RCL-tdT)-D reporter mouse line (Stock No. 007914) and found that 95% of CD103+ intestinal epithelium and lamina propria memory T cells, as well as ~50% of CD103+ naive T cells in the mesenteric lymph nodes, expressed tdTomato fluorescence after tamoxifen exposure. These mice may be useful for tracking and studying the role of CD103+ T cells in epithelial immunity.

Development

The Itgae-creER^T2 knock-in (KI) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. A guide RNA (CTATTTCTAGCTCTAAAACAGATTAGCCCCCTGCTTCCTATAGTGAGTCGTATTA) was used to introduce an IRES-icre/ERT2 fusion gene (a codon-optimized Cre recombinase fused to a human estrogen receptor ligand binding domain) between exon 31 and the 3' UTR of the integrin alpha E, epithelial-associated (Itgae) gene on chromosome 11. Itgae transcript Itgae-201 (ENSMUST00000006101) was used as reference for exon number and sequence. The sgRNA, Cas9 nuclease, and donor plasmid were introduced into the cytoplasm of C57BL/6-derived fertilized eggs with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The resulting Itgae-creER^T2 KI mice were bred to C57BL/6J mice for at least 2 generations by the donating laboratory before crossing to an Ai14(RCL-tdT)-D reporter mouse line (Stock No. 007914). Male mice that were homozygous for the Itgae-creER^T2 KI allele and homozygous for the Ai14(RCL-tdT)-D allele were provided to The Jackson Laboratory. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J (Stock No. 000664) oocytes and resulting recovered progeny were further backcrossed to C57BL/6J for at least one generation to remove the Ai14(RCL-tdT)-D allele.

Allele

Symbol: Itgae^{em1(cre/ERT2)Tber}
Name: endonuclease-mediated mutation 1, Tessa Bergsbaken
MGI accession ID: MGI:8386600
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing; Inducible
Marker symbol: Itgae
Marker name: integrin alpha E, epithelial-associated
Marker synonyms: alpha-E1; CD103; HUMINAE
Chromosome: 11
Strain of origin: C57BL/6
Molecular note: Using CRISPR/Cas9 endonuclease-mediated genome editing, a guide RNA (CTATTTCTAGCTCTAAAACAGATTAGCCCCCTGCTTCCTATAGTGAGTCGTATTA) was used to introduce an IRES-icre/ERT2 fusion gene (a codon-optimized Cre recombinase fused to a human estrogen receptor ligand binding domain) between exon 31 and the 3' UTR of the integrin alpha E, epithelial-associated (Itgae) gene.