C57BL/6-Tcf4^{em1(HBEGF)Fgnx}/J

Stock number: 041681
Product name: Tcf4^{tdTomato-LSL-IRES-DTA}
Research areas: Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

Tcf4^{tdTomato-LSL-IRES-DTA} knock-in mice express a tdTomato fluorescent protein and a Cre-inducible human diphtheria toxin receptor (HBEGF) driven by the Tcf4 endogenous promoter, while retaining endogenous Tcf4 expression. When bred to Cre recombinase-expressing mice, human HBEGF is expressed in Tcf4-expressing cells allowing for ablation of these cells following Diphtheria toxin administration. These mice may be useful for tracking and the conditional depletion of Tcf4-expressing cells.

Detailed description

Tcf4 codes for transcription factor 4 that is highly expressed in the developing central nervous system, immune cells and epithelial/glandular cells. TCF4 plays a role in regulating cell differentiation, neuronal development as well as immune and inflammatory response pathways. These Tcf4^{tdTomato-LSL-IRES-DTA} knock-in mice have a 2A-tdTomato-loxP-stop-loxP-IRES-DTA inserted into the 3' UTR of the Tcf4 gene, while retaining endogenous Tcf4 expression.

Heterozygous and homozygous Tcf4^{tdTomato-LSL-IRES-DTA} mice are viable and fertile with no overt phenotype. When bred to Cre recombinase-expressing mice, human HBEGF (DTA) is expressed in Tcf4-expressing cells allowing for ablation of these cells following Diphtheria toxin administration. tdTomato fluorescence is measurable by FACS. These mice may be useful for tracking and the conditional depletion of Tcf4-expressing cells.

Development

The Tcf4^{tdTomato-LSL-IRES-DTA} knock-in allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. A single guide RNA (GGGAGACGCAGCGAATCACATGG) was used to introduce a 2A-tdTomato-loxP-stop-loxP-IRES-DTA cassette into the 3' UTR of the transcription factor 4 (Tcf4) gene on Chromosome 18. Tcf4 transcript Tcf4-201 (ENSMUST00000066717.12) was used as reference for exon number and sequence. Cas9 nuclease, gRNAs and the donor plasmid containing the 2A-tdTomato-loxP-stop-loxP-IRES-DTA sequence, were introduced into the cytoplasm of zygotes derived from C57BL/6 mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The resulting founder mice were crossed to C57BL/6 mice for at least 2 generations by the donating laboratory. To establish a live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J (Stock No. 000664) oocytes.

Allele

Symbol: Tcf4^{em1(HBEGF)Fgnx}
Name: endonuclease-mediated mutation 1, Florent Ginhoux
MGI accession ID: MGI:8244871
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Reporter; Inserted expressed sequence
Synonyms: Tcf4^{em1(tdTomato,-HBEGF)Fgnx}; Tcf4^{tdTomato-LSL-IRES-DTA}
Marker symbol: Tcf4
Marker name: transcription factor 4
Marker synonyms: 5730422P05Rik; ASP-I2; bHLHb19; CDG2T; E2.2; E2-2; FCD2; FECD3; ITF2; ITF-2; ITF-2b; ME2; MITF-2A; MITF-2B; PTHS; SEF2; SEF-2; SEF2-1; SEF2-1A; SEF2-1B; SEF2-1D; TCF-4; TFE
Chromosome: 18
Strain of origin: C57BL/6
Molecular note: CRISPR/Cas9 genome editing technology was used to insert an IRES-tdTomato-loxP-stop-loxP-2A-HBEGF-Wpre-pA cassette into the 3′ UTR of the Tcf4 gene.