C57BL/6-Il7r^{em1(cre/ERT2)Fgnx}/J

Stock number: 041679
Product name: Il7r^{tdTomato-creERT2}
Research areas: Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

Il7r^{tdTomato-creERT2} knock-in mice express a tdTomato fluorescent protein and a CreERT2 fusion protein driven by the Il7r endogenous promoter, while retaining endogenous Il7r expression. When these mice are bred with mice containing a loxP-flanked sequence of interest, tamoxifen-inducible, Cre-mediated recombination will result in deletion of the floxed sequences in the Il7r-expressing cells of the offspring. These mice may be useful for lineage-tracing or marking Il7r-expressing cells, such as T cells, B-cell precursors, and some dendritic cells.

Detailed description

The IL7 receptor is important in the regulation of T, B, and NK lymphoid cell development. The Il7r, interleukin 7 receptor, gene encodes a subunit of the IL-7 receptor, which is essential for T cell development and V(D)J recombination. These Il7r^{tdTomato-creERT2} knock-in mice have a T2A-tdTomato-P2A-creERT2-Wpre-pA cassette inserted into the 3' UTR of the Il7r gene, while retaining endogenous Il7rexpression.

Heterozygous and homozygous Il7r^{tdTomato-creERT2} mice are viable and fertile with no overt phenotype. When these mice are bred with mice containing a loxP-flanked sequence of interest, tamoxifen-inducible, Cre-mediated recombination will result in deletion of the floxed sequences in the Il7r-expressing cells of the offspring. tdTomato expression is measurable by FACS. These mice may be useful for lineage-tracing or marking Il7r-expressing cells, such as T cells, B-cell precursors, and some dendritic cells.

The Cre-ERT2 fusion protein consists of a codon-improved Cre recombinase fused to a triple mutant form of the human estrogen receptor, which does not bind its natural ligand (17β-estradiol) at physiological concentrations but will bind the synthetic estrogen receptor ligands 4-hydroxytamoxifen (OHT or tamoxifen) and, with lesser sensitivity, ICI 182780. Restricted to the cytoplasm, Cre-ERT2 can only gain access to the nuclear compartment after exposure to tamoxifen. To counteract the mixed estrogen agonist effects of tamoxifen injections, which can result in late fetal abortions in pregnant mice, progesterone may be co-administered.

Development

The Il7r^{tdTomato-creERT2} knock-in allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. A single guide RNA (CAACCAAATGATCACTGAGATGG) was used to introduce a T2A-tdTomato-P2A-creERT2-Wpre-pA cassette into the 3' UTR of the interleukin 7 receptor (Il7r) gene on chromosome 15. Il7r transcript Il7r-201 (ENSMUST00000003981.6) was used as a reference for exon number and sequence. Cas9 nuclease, gRNAs, and the donor plasmid containing the T2A-tdTomato-P2A-creERT2-Wpre-pA sequence were introduced into the cytoplasm of zygotes derived from C57BL/6 mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The resulting founder mice were crossed to C57BL/6 mice for at least 2 generations by the donating laboratory. To establish a live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J (Stock No. 000664) oocytes.

Allele

Symbol: Il7r^{em1(cre/ERT2)Fgnx}
Name: endonuclease-mediated mutation 1, Florent Ginhoux
MGI accession ID: MGI:8244870
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing; Reporter; Inducible
Synonyms: Il7r^{em1(tdTomato,-cre/ERT2)Fgnx}; Il7r^{tdTomato-creERT2}
Marker symbol: Il7r
Marker name: interleukin 7 receptor
Marker synonyms: CD127; CDW127; IL-7 receptor alpha chain; IL7RA; IL7Ralpha; IL-7Ralpha; IL-7R-alpha; ILRA; IMD104; lnc-IL7R; sIL-7R
Chromosome: 15
Strain of origin: C57BL/6
Molecular note: CRISPR/Cas9 genome editing technology was used to insert an IRES-tdTomato-2A-creERT2-Wpre-pA cassette into the 3′ UTR of the Il7r gene.