NOD/ShiLtJ-Prkdc^em1Gmcr Il2rg^em1Gmcr/J

Stock number: 041557
Product name: N2G
Strain synonyms: NOD-2-Genes KO , NOD-Prkdc^em1Gmcr Il2rg^em1Gmcr
Research areas: Cancer Research, Hematological Research, Immunology, Inflammation and Autoimmunity Research, Internal/Organ Research, Research Tools, Virology Research

Description

The NOD-2-Gene-deletion mouse (N2G) contains complete deletions of both Prkdc (protein kinase, DNA activated, catalytic polypeptide) and the X-linked Il2rg (interleukin 2 receptor, gamma chain) genes. This immunodeficient mouse model is an ideal platform for human cell and tissue transplantation, as well as other translational research applications.

Detailed description

The NOD-2-Gene-deletion mouse (N2G) contains complete deletions of both Prkdc (protein kinase, DNA activated, catalytic polypeptide) and the X-linked Il2rg (interleukin 2 receptor, gamma chain) genes.

The N2G mouse model is a highly immunodeficient strain based on the classical NOD background. Instead of conventional gene-targeting, CRISPR/Cas9-mediated knockouts of Prkdc and Il2rg ensure a more complete ablation of immune function. This strain is an ideal platform for human cell and tissue transplantation, as well as other translational research applications

N2G mice homozygous for the Prkdc deletion and females that are homozygous for the X-linked Il2rg deletion and males that are hemizygous for the Il2rg deletion are viable and fertile.

Development

The NOD-2-Gene-deletion mouse (N2G) contains complete deletions of both Prkdc (protein kinase, DNA activated, catalytic polypeptide) and the X-linked Il2rg (interleukin 2 receptor, gamma chain) genes.

CRISPR RNAs (crRNAs) were designed to target exon 3 (GAGAGTAATGCATAACCTTC and ACTCTCTTGATATTAAGGTA) and exon 86 (GTTAGTTAGGCCATTAGCAT and TGGTTCACTGCCTCCAATAT) of the endogenous Prkdc gene. Dual guide RNAs, consisting of a crRNA and a trans-activating crRNA (tracrRNA), and the Cas9 protein were micro-injected into fertilized eggs from NOD/ShiLtJ mice (Stock No. 001976). Correctly targeted embryos were transferred to pseudopregnant females and resulting Prkdc null mice were backcrossed to NOD mice to minimize potential off-target mutations.

crRNAs were also designed to target the promoter (CCTGAGGTTTCAAGTCGGGC and GATGATGCTATTTATTAAGCACAA) and exon 8 (GAAATCGAAACTTAGCCCCA and ACACTCTCAAGTAGGGCATA) of the Il2rg gene. Dual guide RNAs and the Cas9 protein were micro-injected into fertilized eggs from NOD mice and correctly targeted embryos were transferred to pseudopregnant females. Il2rg null mice were backcrossed to NOD mice to minimize potential off-target mutations.

To create this line of NOD-2-Gene-deletion (N2G) mice, offspring carrying the Prkdc deletion were crossed to those carrying the X-linked Il2rg deletion. Cryopreserved sperm was sent to The Jackson Laboratory. Upon arrival, an aliquot of frozen sperm was used to fertilize NOD/ShiLtJ oocytes.

Allele

Symbol: Prkdc^em1Gmcr
Name: endonuclease-mediated mutation 1, Gemcro Inc
MGI accession ID: MGI:8322626
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Prkdc
Marker name: protein kinase, DNA activated, catalytic polypeptide
Marker synonyms: DNAPDcs; DNAPK; DNA-PK; DNAPKc; DNA-PKC; DNA-PKcs; DNPK1; DOXNPH; dxnph; HYRC; HYRC1; IMD26; p350; S473K; slip; XRCC7
Chromosome: 16
Strain of origin: NOD/ShiLtJ
Molecular note: Using CRISPR technology, exons 3 and 86 of the endogenous Prkdc gene were targeted to delete the Prkdc gene.

Allele

Symbol: Il2rg^em1Gmcr
Name: endonuclease-mediated mutation 1, Gemcro Inc
MGI accession ID: MGI:8322627
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Il2rg
Marker name: interleukin 2 receptor, gamma chain
Marker synonyms: [g]c; Ab2-183; Cd132; CIDX; common cytokine receptor gamma chain; common gamma chain; gamma C receptor; gamma(c); gammaC; gc; IL-2RG; IMD4; P64; SCIDX; SCIDX1
Chromosome: X
Strain of origin: NOD/ShiLtJ
Molecular note: Using CRISPR technology, promoter and exon 8 of the endogenous Il2rg gene were targeted to delete the Il2rg gene.