C57BL/6N-Ace2^em5Gmcr/J

Stock number: 041556
Product name: hiACE2
Strain synonyms: Ace2^{N24Q,N30D,N31K,Q34H,T79L,S82M,F83Y,S84P,H353K}
Research areas: Developmental Biology Research, Immunology, Inflammation and Autoimmunity Research, Internal/Organ Research, Mouse/Human Gene Homologs, Research Tools, Virology Research

Description

Humanized Knock-in ACE2 (hiACE2) mice contain nine point mutations in exons 1, 2, and 8 of the endogenous X-linked angiotensin converting enzyme 2 (Ace2) gene that are homologous to human ACE2 sequence. These amino acids (24Q, 30D, 31K, 34H, 79L, 82M, 83Y, 84P, and 353K) are required for binding of coronavirus' spike protein and have previously been shown to increase susceptibility to SARS‐CoV‐2 in mouse models of infection. hiACE2 mice are a valuable tool for testing SARS‐CoV‐2 vaccines and therapeutics and for studying disease mechanisms for guiding more targeted and effective treatments.

Detailed description

Humanized Knock-in ACE2 (hiACE2) mice contain nine point mutations in exons 1, 2, and 8 of the endogenous X-linked angiotensin converting enzyme 2 (Ace2) gene that are homologous to human ACE2 sequence. These amino acids (24Q, 30D, 31K, 34H, 79L, 82M, 83Y, 84P, and 353K) are required for binding of coronavirus' spike protein and have previously been shown to increase susceptibility to severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) in mouse models of infection.

This mouse model enables efficient SARS‐CoV‐2 replication in respiratory organs without detectable infection in the central nervous system. It mirrors the age‐ and sex‐specific patterns of morbidity and mortality, as well as the immunopathological features observed in human COVID‐19 cases. hiACE2 mice are a valuable tool for testing SARS‐CoV‐2 vaccines and therapeutics and for studying disease mechanisms for guiding more targeted and effective treatments.

Homozygous hiACE2 mice are viable and fertile.

Development

To create this line of Humanized Knock-in ACE2 (hiACE2) mice, CRISPR RNAs (crRNAs) sequences for Cpf1 were designed to target exon 1 and exon 2, and crRNAs for Cas9 were designed to target exon 8 of the endogenous Ace2 gene (based on Ace2-202 ENSMUST00000112271.10).

Specifically, four mutations corresponding to human ACE2 sequence (T79L, S82M, F83Y, and S84P) were introduced into exon 2 of Ace2 using crRNAs (TTGTAGTGAGAAACTTTGGGC GGCAGTCTTAGACTGTTCTTC), a single-stranded oligo-deoxyribonucleotide (ssODN), and Cpf1 protein in embryos from C57BL/6NTac mice. The resulting founder mice were bred to C57BL/6NTac mice, and the correct mutations were confirmed using PCR and Sanger sequencing.

Embryos from these exon 2 KI mice were then used to create four more mutations homologous to human ACE2 sequence (N24Q, N30D, N31K, and Q34H) in exon 1 of Ace2 using crRNAs (AACAACTTTAATCAGGAAGC and ATCAGGAAGCTGAAGACCTGT), a ssODN, and Cpf1 protein. The resulting exon 1/2 KI mice founder mice were bred to C57BL/6NTac mice, and the correct mutations were confirmed using PCR and Sanger sequencing.

Embryos from these exon 1/2 KI mice were then used to create one last mutation homologous to human ACE2 sequence (H353K) in exon 8 of Ace2 using crRNAs (ACACGGAGACTTCAGGTAGT and ATCTGGGACACGGAGACTTC), a ssODN, and Cas9 protein.

Resulting mice with mutations in all three exons, exon 1/2/8 KI hiACE2 mice, were identified by PCR and Sanger sequencing, and correctly targeted offspring were further bred to C57BL/6NTac mice for at least 2 generations by the donating laboratory to remove any off-target CRISPR sites. Cryopreserved sperm was sent to The Jackson Laboratory. Upon arrival, an aliquot of frozen sperm was used to fertilize C57BL/6NJ oocytes (Stock No. 005304).

Allele

Symbol: Ace2^em5Gmcr
Name: endonuclease-mediated mutation 5, Gemcro Inc
MGI accession ID: MGI:8322622
Generation method: Endonuclease-mediated
Attributes: Humanized sequence
Synonyms: hiACE2
Marker symbol: Ace2
Marker name: angiotensin I converting enzyme (peptidyl-dipeptidase A) 2
Marker synonyms: 2010305L05Rik; ACEH
Chromosome: X
Strain of origin: C57BL/6NTac
Molecular note: Using CRISPR technology, N24Q*N30D*N31K*Q34H*T79L*S82M*F83Y*S84P*H353K mutations were introduced into the endogenous Ace2 gene (based on Ace2-202 ENSMUST00000112271.10).