C57BL/6N-Fcgrt^{em1(FCGRT)Gmcr}/J

Stock number: 041555
Product name: hiFcRn
Strain synonyms: humanized FcRn knock-in , B6-Fcgrt^{em1(FCGRT)Gmcr}
Research areas: Immunology, Inflammation and Autoimmunity Research, Research Tools, Virology Research

Description

Humanized Knock-in FcRn (hiFcRn) mice integrate human FCGRT cDNA (hFcRn), lacking the signal peptide, into the endogenous locus of the mouse Fcgrt gene (mFcRn), completely replacing native mouse FcRn expression. The hiFcRn mouse model offers a human-relevant platform for studying the pharmacokinetics of IgG-based therapeutics and optimizing Fc engineering for clinical translation.

Detailed description

Humanized Knock-in FcRn (hiFcRn) mice integrate the human Fc fragment of IgG receptor and transporter (FCGRT) cDNA (hFcRn), lacking the signal peptide, into the endogenous locus of the mouse Fcgrt gene (mFcRn), completely replacing native mFcRn expression. The hFcRn cDNA lacking the signal peptide is positioned between the promoter region and the native mFcRn coding sequence while keeping the endogenous murine signal peptide. A stop codon and poly A signal in the inserted cassette including the hFcRn cDNA ablates mFcRn expression, while allowing hFcRn to be expressed under the control of the native mFcRn promoter. This design preserves the tissue-specific and temporal expression patterns of FcRn more closely than exogenous-promoter-based approaches.

Homozygous hiFcRn mice are viable and fertile and display a complete absence of murine FcRn protein expression, ensuring exclusive human FcRn expression. Levels of FCGRT mRNA in homozygous mice are comparable to those of mFcRn in wild-type controls. In heterozygous mice, both Fcgrt and FCGRT are expressed at intermediate levels, further confirming that hiFcRn mice effectively preserve native regulation of FcRn expression.

The hiFcRn mouse model offers a human-relevant platform for studying the pharmacokinetics of IgG-based therapeutics and optimizing Fc engineering for clinical translation.

Development

To create this line of humanized Knock-in FcRn (hiFcRn) mice, sgRNAs (ACCAGGACCTGGAGTGTGTC and GGCTCAGGTAAGAGGCCACC) were designed to target the endogenous Fc fragment of IgG receptor and transporter (Fcgrt) gene for introduction of a human FCGRT cDNA lacking the signal peptide (based on Fcgrt-203 ENSMUST00000210642.2). A 21-amino-acid signal peptide sequence from the murine Fcgrt gene was fused to the 5' end of the hFcRn cDNA. An SV40 polyA signal was inserted at the 3' region of hFcRn cDNA lacking the signal peptide to ensure efficient termination of transcript and enhanced mRNA stability. sgRNA, the cas9 protein, and the dsDNA template were introduced into C57BL/6NTac-derived embryos with well-recognized pronuclei. Injected embryos were transferred to pseudopregnant females. Resulting hiFcRn mice were identified by PCR and Sanger sequencing, and correctly targeted offspring were further bred to C57BL/6NTac mice for at least 2 generations by the donating laboratory to remove any off-target CRISPR sites. Cryopreserved sperm was sent to The Jackson Laboratory. Upon arrival, an aliquot of frozen sperm was used to fertilize C57BL/6NJ oocytes.

Allele

Symbol: Fcgrt^{em1(FCGRT)Gmcr}
Name: endonuclease-mediated mutation 1, Gemcro Inc
MGI accession ID: MGI:8322618
Generation method: Endonuclease-mediated
Attributes: Inserted expressed sequence; Humanized sequence
Marker symbol: Fcgrt
Marker name: Fc receptor, IgG, alpha chain transporter
Marker synonyms: alpha-chain; FcgammaRn; FCRN; neonatal Fc receptor
Chromosome: 7
Strain of origin: C57BL/6NTac
Molecular note: sgRNAs (ACCAGGACCTGGAGTGTGTC and GGCTCAGGTAAGAGGCCACC) were designed to target the endogenous Fc fragment of IgG receptor and transporter (Fcgrt) gene for introducing human FCGRT cDNA lacking the signal peptide (based on Fcgrt-203 ENSMUST00000210642.2). A 21-amino-acid signal peptide sequence from the murine Fcgrt gene was fused to the 5' end of the hFcRn cDNA. An SV40 polyA signal was inserted at the 3' region of hFcRn cDNA lacking the signal peptide to ensure efficient termination of transcript and enhanced mRNA stability.