C57BL/6J-Sprr1a^em2Esml/J

Stock number: 041450
Product name: Sprr1a-GFP
Strain synonyms: BZ^GFP
Research areas: Cardiovascular Research, Research Tools

Description

Sprr1a-GFP knock-in/knock-out mice have a membrane bound GFP (mGFP) reporter sequence inserted adjacent to the start codon of the Sprr1a gene. These mice may be useful for visualizing and isolating border zone (BZ) cardiomyocytes in translational studies of recovery from regenerative or non-regenerative cardiac insult.

Detailed description

Sprr1a-GFP knock-in/knock-out mice have a membrane bound GFP (mGFP) reporter sequence inserted adjacent to the start codon of the small proline-rich protein 1A (Sprr1a) gene. This insertion also results in a deletion of 10 bp. Sprr1a encodes a keratinocyte protein involved in cornification envelope formation. In the heart, it is a stress-inducible protein that has been linked to cardiac remodeling after injury. In these Sprr1a-GFP mice, mGFP fluorescence is transiently detectable specifically in border zone cardiomyocytes between 3-14 days post-myocardial infarction (MI) via direct fluorescence, immunofluorescence, and FACS. SPRR1A levels return to background, and are nearly undetectable by 28 days post-MI.

Homozygous mice are viable and fertile. These mice may be useful for visualizing and isolating border zone (BZ) cardiomyocytes in translational studies of recovery from regenerative or non-regenerative cardiac insult.

Development

A sgRNA (CTTCTGCTGGTGGGAACTCA TGG) was designed to target exon 2, adjacent to the start codon, of the small proline-rich protein 1A (Sprr1a) gene (based on Sprr1a-201 ENSMUST00000054599.8) with a membrane bound green fluorescence protein sequence (mGFP). This insertion also results in a deletion of 10 bp. sgRNA, a repair template, and the Cas9 RNA were electroporated into the cytoplasm of embryos derived from C57BL/6J mice. Targeted embryos were transferred to pseudopregnant females. Correctly targeted pups were identified by PCR and Sanger sequencing, and resulting Sprr1a-GFP knock-in/knock-out mice were further bred to C57BL/6J mice (Stock No. 000664) for at least 3 generation by the donating lab to remove off-target CRISPR sites. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Sprr1a^em2Esml
Name: endonuclease-mediated mutation 2, Eric Small
MGI accession ID: MGI:8278873
Generation method: Endonuclease-mediated
Attributes: Reporter; Null/Knockout
Marker symbol: Sprr1a
Marker name: small proline-rich protein 1A
Marker synonyms: Spr; Spr1a; SPRK; Sprr; Sprr1; Sprr1al; Sprr1b
Chromosome: 3
Strain of origin: C57BL/6J
Molecular note: A sgRNA (CTTCTGCTGGTGGGAACTCA TGG) was designed to target exon 2, adjacent to the start codon, of the small proline-rich protein 1A (Sprr1a) gene with a membrane bound green fluorescence protein sequence (mGFP). This insertion also results in a deletion of 10 bp.