C57BL/6J-Sprr1a^{em1(cre/ERT2)Esml}/J

Stock number: 041449
Product name: Sprr1a-CreERT2
Research areas: Cardiovascular Research, Research Tools

Description

Sprr1a-CreERT2 knock-in/knock-out mice have a tamoxifen-inducible cre/ERT2 sequence inserted adjacent to the start codon of the Sprr1a gene. This insertion also results in a deletion of 10 bp. These mice may be useful for gene deletion/overexpression studies of BZ cardiomyocytes and for visualizing, tracing, and isolating border zone cardiomyocytes in translational studies of recovery from regenerative or non-regenerative cardiac insult.

Detailed description

Sprr1a-CreERT2 knock-in/knock-out mice have a tamoxifen-inducible cre/ERT2 fusion gene sequence inserted adjacent to the start codon of the small proline-rich protein 1A (Sprr1a) gene. Sprr1a encodes a keratinocyte protein involved in cornification envelope formation. In the heart, it is a stress-inducible protein that has been linked to cardiac remodeling after injury. In these Sprr1a-CreERT2 mice, cre/ERT2 expression is detectable specifically in border zone cardiomyocytes after injury. The donating investigator reports no Cre activity in the heart (post-myocardial infarction) or skin prior to tamoxifen administration.

Homozygous mice are viable and fertile. When Sprr1a-CreERT2 mice are bred to mTmG reporter mice (Stock No. 007676), administration of tamoxifen injection at 3-5 days post-myocardial infarction results in expression of GFP specifically in border zone cardiomyocytes in resulting BZ^Lin; Rosa^mTmG offspring.

Development

A sgRNA (CTTCTGCTGGTGGGAACTCA TGG) was designed to target exon 2, adjacent to the start codon, of the small proline-rich protein 1A (Sprr1a) gene (based on Sprr1a-201 ENSMUST00000054599.8) with a tamoxifen-inducible cre/ERT2 fusion gene sequence. This insertion also results in a deletion of 10 bp. sgRNA, a repair template, and the Cas9 RNA were electroporated into the cytoplasm of embryos derived from C57BL/6J mice. Targeted embryos were transferred to pseudopregnant females. Correctly targeted pups were identified by PCR and Sanger sequencing, and resulting Sprr1a-CreERT2 knock-in/knock-out mice were further bred to C57BL/6J mice (Stock No. 000664) for 3 generations by the donating lab to remove off-target CRISPR sites. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Sprr1a^{em1(cre/ERT2)Esml}
Name: endonuclease-mediated mutation 1, Eric Small
MGI accession ID: MGI:8278875
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing; Null/Knockout
Marker symbol: Sprr1a
Marker name: small proline-rich protein 1A
Marker synonyms: Spr; Spr1a; SPRK; Sprr; Sprr1; Sprr1al; Sprr1b
Chromosome: 3
Strain of origin: C57BL/6J
Molecular note: A sgRNA (CTTCTGCTGGTGGGAACTCA TGG) was designed to target exon 2, adjacent to the start codon, of the small proline-rich protein 1A (Sprr1a) gene with a tamoxifen-inducible cre/ERT2 fusion gene sequence. This insertion also results in a deletion of 10 bp.