C57BL/6J-Slco1c1^{em1(icre/ERT2)Wopg}/J

Stock number: 041412
Product name: Slco1c1-CreER , Slco1c1-KI-P2A-iCreERT2
Research areas: Developmental Biology Research, Neurobiology Research, Research Tools

Description

Slco1c1-CreER knock-in (KI) mice express a codon-optimized CreER fusion protein driven by the Slco1c1 endogenous promoter, while retaining endogenous Slco1c1 expression. When bred with mice containing a loxP-flanked sequence of interest, tamoxifen-inducible Cre-mediated recombination will result in deletion of the floxed sequences in Slco1c1-expressing cells of the offspring. These mice may be useful when studying the transport of thyroid hormones into the brain across the blood-brain barrier (BBB) and into neurons for proper brain development and function.

Detailed description

Slco1c1-CreER knock-in (KI) mice have a P2A-iCreERT2 cassette inserted immediately after the stop codon of the solute carrier organic anion transporter family, member 1c1 (Slco1c1) gene, allowing for co-expression of endogenous SLCO1C1 and Cre/ERT2 fusion protein. Slco1c1 encodes a transmembrane protein that mediates the sodium-independent uptake of thyroid hormones in brain tissues and facilitates their transport across the blood-brain barrier and into glia in the brain. In this strain, SLCO1C1 directs expression of the tamoxifen-inducible iCre recombinase specifically to endothelial cells in the brain and epithelial cells of the choroid plexus.

Heterozygous and homozygous Slco1c1-CreER KI mice are viable and fertile with no overt phenotype. When bred with mice containing a loxP-flanked sequence of interest, tamoxifen-inducible, Cre-mediated recombination will result in deletion of the floxed sequences in the Slco1c1-expressing cells of the offspring. These mice may be useful when studying the transport of thyroid hormones into the brain across the blood-brain barrier (BBB) and into neurons for proper brain development and function.

Development

The Slco1c1-CreER knock-in (KI) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. A single guide RNA (AAAGGAGACATGCGCTGCAAGG) was used to introduce aP2A-iCreERT2 cassette immediately after stop codon of the solute carrier organic anion transporter family, member 1c1 (Slco1c1) gene on chromosome 6. Slco1c1 transcript Slco1c1_201 (NM_02147.3, ENSMUST00000032362.11) was used as reference for sequence and exon number. The sgRNAs, ssDNA and the Cas9 nuclease mRNA were introduced into the cytoplasm of zygotes derived from C57BL/6J (Stock No. 000664) mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The resulting Slco1c1-CreER knock-in mice were bred to C57BL/6J mice for 3 generations to reduce off-target events. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Slco1c1^{em1(icre/ERT2)Wopg}
Name: endonuclease-mediated mutation 1, Woo-ping Ge
MGI accession ID: MGI:8280765
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing; Inducible
Synonyms: Slco1c1-CreER^KI; Slco1c1-KIP2A- iCreERT2
Marker symbol: Slco1c1
Marker name: solute carrier organic anion transporter family, member 1c1
Marker synonyms: BAST1; Bsat1; OATP1; OATP14; OATP-14; OATP1C1; OATPF; OATP-F; OATPRP5; OATP-RP5; SLC21A14
Chromosome: 6
Strain of origin: C57BL/6J
Molecular note: Using CRISPR/Cas9 endonuclease-mediated genome editing, a single guide RNA (AAAGGAGACATGCGCTGCAAGG) was used to introduce aP2A-iCreERT2 cassette immediately after stop codon of the solute carrier organic anion transporter family, member 1c1 (Slco1c1) gene.