C57BL/6J-Gt(ROSA)26Sor^{em3(CAG-TFRC/OVAL)Dest}/J

Stock number: 041333
Product name: Rosa26-tmOVA
Research areas: Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

Rosa26-tmOVA mice harbor a Cre-inducible transmembrane ovalbumin sequence, which is N-terminally fused to the transferrin receptor (TFR) transmembrane domain, and 3xFLAG, knocked into the Gt(ROSA)26Sor locus. These mice may be useful for studying tissue-specific T cell immunity and developing and evaluating cell-specific immune-based therapies, such as antigen receptor T cell therapeutics.

Detailed description

Rosa26-tmOVA mice express a floxed STOP cassette followed by a human transferrin receptor (TFRC; the residues 1-118) fused to the mature chicken ovalbumin (OVAL; the residues 139-386) lacking the signal peptide sequence, and a C-terminal 3xFLAG tag for protein detection, knocked into the Gt(ROSA)26Sor locus. When bred to mice that express tissue-specific Cre recombinase, the resulting offspring will express the TFRC/OVAL fusion gene in cre-expressing tissues. Homozygous mice are viable and fertile. However, the investigator reported that a portion of homozygous tmOVA female mice will die during breeding. Male homozygous mice have no issue with viability/fertility. These Rosa26-tmOVA mice allow precise, potentially temporal control over antigen expression and may be useful for investigating T cell responses and antigen-presenting cell (APC) requirements.

When bred to Villin^CRE-ERT2 mouse line (Stock No. 020282), in which Cre is expressed in intestinal epithelial cells and translocates to the nucleus after tamoxifen administration, OVA mouse lines robustly expressed OVA along the gut.

Of note, the investigator donated mice expressing OVA protein in different cellular compartments: secreted Rosa26-sOVA (Stock No. 041322), cytosolic Rosa26-cOVA (Stock No. 041332), and transmembrane Rosa26-tmOVA (this line).

Development

The Rosa26-tmOVA allele was generated by CRISPR/Cas9 endonuclease-mediated genome editing using crRNAs (ACTCCAGTCTTTCTAGAAGA) and tracrRNAs (Alt-R™ CRISPRCas9-tracrRNA, IDT, 1072533) to insert a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), a loxP-flanked Neo/STOP cassette, residues 1-118 of the human transferrin receptor (TFRC) fused to residues 139-386 of the chicken ovalbumin gene (OVAL) from Addgene 64600, a 3XFLAG tag, and a bovine growth hormone polyadenylation signal (bGHpolyA) into the Gt(ROSA)26Sor locus on Chromosome 6. The annealed crRNA:tracrRNA, ssDNA (repair template), and the Cas9 nuclease protein were introduced into the cytoplasm of zygotes derived from C57BL/6J (Stock No. 000664) mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The resulting Rosa26-tmOVA founders were backcrossed to the C57BL/6J mice for at least 11 generations before being maintained by intercrosses. Upon arrival at The Jackson Laboratory, sperm were cryopreserved. To establish a live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Gt(ROSA)26Sor^{em3(CAG-TFRC/OVAL)Dest}
Name: endonuclease-mediated mutation 3, Daria Esterhazy
MGI accession ID: MGI:8283244
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Inserted expressed sequence; Epitope tag
Synonyms: Rosa26-tmO
Marker symbol: Gt(ROSA)26Sor
Marker name: gene trap ROSA 26, Philippe Soriano
Marker synonyms: beta geo; Gtrgeo26; Gtrosa26; R26; ROSA26; SETD5-AS1; Thumpd3as1
Chromosome: 6
Strain of origin: C57BL/6J
Molecular note: The allele was generated by CRISPR/Cas9 endonuclease-mediated genome editing using crRNAs (ACTCCAGTCTTTCTAGAAGA) and tracrRNAs to insert a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), a loxP-flanked Neo/STOP cassette, residues 1-118 of the human transferrin receptor (TFRC) fused to residues 139-386 of the chicken ovalbumin gene (OVAL), a 3XFLAG tag, and a bovine growth hormone polyadenylation signal (bGHpolyA) into the Gt(ROSA)26Sor locus on Chromosome 6.