C57BL/6J-Tcf19^em1Jsun/J

Stock number: 041309
Product name: Tcf19^- GFP KI/KO
Research areas: Cancer Research, Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

Tcf19^- GFP knock-in/knock-out (KI/KO) mice have a GFP sequence replacing exon 2 of the Tcf19 gene, resulting in complete loss of transcription factor 19. These mice may be useful for tracking Tcf19-expressing cell lineages, such as pancreatic β cells, CD8+ T cells and Natural Killer (NK) cells.

Detailed description

Transcription factor 19 (coded by Tcf19) is involved in cell proliferation, apoptosis, and immunity. TCF19 is primarily expressed in pancreatic β cells, CD8+ T cells, and Natural Killer (NK) cells. These Tcf19- GFP knock-in/knock-out (KI/KO) mice have a GFP sequence and an early stop signal replacing exon 2 of the Tcf19 gene, resulting in the complete loss of transcription factor 19.

Heterozygous and homozygous mice are viable and fertile with no overt phenotype. The donating laboratory confirmed that GFP expression recapitulates endogenous Tcf19 expression in NK cells after MCMV infection. GFP fluorescence is detectable by immunoblot and flow cytometry. These mice may be useful for tracking Tcf19-expressing cell lineages, such as pancreatic β cells, CD8+ T cells and NK cells.

Development

The Tcf19^- GFP knock-in/knock-out (KI/KO) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs (GTTTCCAGCTGCTGCGTATA, tagcctacaccggacctaag, and GGTGGGCAAAGTGGTGCAGA) were used to replace exon 2 of the transcription factor 19 (Tcf19) gene on chromosome 17 with a green fluorescent protein (GFP) sequence and an early stop signal. The sgRNA, donor plasmid, and Cas9 nuclease were introduced into the cytoplasm of zygotes derived from C57BL/6J mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The resulting Tcf19^- GFP knock-in/knock-out (KI/KO) mice were backcrossed to C57BL/6J mice for 3 generations by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish a live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J (Stock No. 000664) oocytes.

Allele

Symbol: Tcf19^em1Jsun
Name: endonuclease-mediated mutation 1, Joseph C. Sun
MGI accession ID: MGI:8268513
Generation method: Endonuclease-mediated
Attributes: Reporter; Null/Knockout
Synonyms: Tcf19^- GFP
Marker symbol: Tcf19
Marker name: transcription factor 19
Marker synonyms: 5730403J10Rik; SC1; TCF-19
Chromosome: 17
Strain of origin: C57BL/6J
Molecular note: Using CRISPR/Cas9 endonuclease-mediated genome editing, the guide RNAs (GTTTCCAGCTGCTGCGTATA, tagcctacaccggacctaag and GGTGGGCAAAGTGGTGCAGA) were used to replace exon 2 of the transcription factor 19 (Tcf19) gene with a green fluorescent protein (GFP) sequence and an early stop signal.