C57BL/6J-Il21r^em1Jsun/J

Stock number: 041306
Product name: Il21r-flox
Research areas: Cancer Research, Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

Il21r-floxed mice possess loxP sites flanking exon 3 of the Il21r gene. These mice may be useful for generating conditional mutants when studying regulation of immune response pathways and long-term humoral immunity.

Detailed description

Il21r (interleukin 21 receptor) encodes a type I cytokine receptor for IL21 and is expressed on T, B and NK cells. It is involved in immunoglobulin production, B cell differentiation, NK cell activation and function, and Th17 differentiation. These Il21r-floxed mice have loxP sites flanking exon 3 of the Il21r gene.

Heterozygous and homozygous mice are viable and fertile with no overt phenotype. When bred to mice that express tissue-specific Cre recombinase, resulting offspring will have exon 3 deleted, resulting in complete loss of IL21R in the cre-expressing tissues. When these floexed mice are bred to Cd23-Cre mice (Stock No. 028197), resulting Il21r^fl/fl::Cd23-cre progeny lacked IL-21-induced STAT1/3 phosphorylation, apoptosis, and expansion of IgG1+ B cells, confirming complete loss of IL-21. These mice may be useful for studying the regulation of immune response pathways and long-term humoral immunity.

Development

The Il21r-floxed allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs (aaacactttgaatccactat and ttgctaccatgttccagtcg) were used to target exon 3 of the interleukin 21 receptor (Il21r) gene on chromosome 7. Il21r transcript NM_021887.2 was used as reference for the exon number and the guide sequences. The sgRNA, donor plasmid, and Cas9 nuclease were introduced into the cytoplasm of zygotes derived from C57BL/6J mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The resulting Il21r-floxed mice were backcrossed to C57BL/6J mice for at least 1 generation by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish a live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J (Stock No. 000664) oocytes.

Allele

Symbol: Il21r^em1Jsun
Name: endonuclease-mediated mutation 1, Joseph C. Sun
MGI accession ID: MGI:8161703
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed)
Synonyms: Il21r^em1Jaych; Il21r-flox
Marker symbol: Il21r
Marker name: interleukin 21 receptor
Marker synonyms: CD360; IMD56; NILR
Chromosome: 7
Strain of origin: C57BL/6J
Molecular note: LoxP sites were inserted to flank exon 3 via CRISPR/Cas9 genome editing technology.