C57BL/6J-Wdr45^em1Ljpi/J

Stock number: 041170
Product name: Wdr45c52c>t
Research areas: Cell Biology Research, Developmental Biology Research, Neurobiology Research

Description

Wdr45c52c>t knock-in mice harbor a clinical point mutation (C >T) in the Wdr45 gene, leading to loss of WDR45 protein expression. These mice may be useful when studying Beta-Propeller Protein-Associated Neurodegeneration (BPAN).

Detailed description

WD repeat domain 45 (coded by Wdr45) plays an essential role in the autophagy pathway, as well as brain development and synaptogenesis. Mutations in this gene have been associated with neurodevelopmental and neurodegenerative disorders, such as Beta-propeller protein-associated neurodegeneration (BPAN). BPAN patients present with intellectual disability, seizures, and motor dysfunction (ataxia). These Wdr45c52c>t knock-in mice harbor a clinical point mutation (C > T) in the first coding exon of the Wdr45 gene on chromosome X.

Heterozygous females and hemizygous males are viable and fertile. Homozygous females are also viable and fertile, but tend to demonstrate poor maternal care and a high rate of cannibalization of litters; therefore, the donating laboratory recommends breeding heterozygous females with hemizygous males. Hemizygous males show a decrease in body weight compared to sex-matched littermate controls. Both homozygous females and hemizygous males demonstrate altered perinatal vocalizations, hyperactivity, learning and memory deficits as well as motor dysfunction as early as 3 months of age. These mice may be useful when studying BPAN and potential therapeutics.

Development

The Wdr45c52c>t knock-in allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. A single guide RNA (UCAUAAGCUUACUUUGGUCU) was used to target the first coding exon of the WD repeat domain 45 (Wdr45) gene on chromosome X. Wdr45 transcript Wdr45-204 (ENSMUST00000115689.10) was used as reference for the exon number and the guide sequences. The sgRNAs, donor single-stranded oligodeoxynucleotide, containing the C >T point mutation, and Cas9 nuclease were introduced in utero into one-cell stage zygotes from C57BL/6J mice using improved-Genome editing via Oviductal Nucleic Acids Delivery (iGONAD). Correctly targeted pups were identified by PCR and sequencing. The resulting Wdr45c52c>t mice were crossed to C57BL/6J mice for at least 2 generations by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

Allele

Symbol: Wdr45^em1Ljpi
Name: endonuclease-mediated mutation 1, Louis-Jan Pilaz
MGI accession ID: MGI:8240257
Generation method: Endonuclease-mediated
Attributes: Null/Knockout; Humanized sequence
Synonyms: Wdr45 c52C T
Marker symbol: Wdr45
Marker name: WD repeat domain 45
Marker synonyms: C79260; DXImx38e; JM5; NBIA4; NBIA5; Sfc19; Wdrx1; WIPI4; WIPI-4
Chromosome: X
Strain of origin: C57BL/6J
Molecular note: CRISPR-targeting of the first coding exon replicated a point mutation (c.52C>T) identified in patients with Beta-propeller Protein Associated Neurodegeneration (BPAN) that introduces a stop codon early in the coding sequence (p.Q18*).