C57BL/6-Gt(ROSA)26Sor^{em1(CAG-KCNJ2)Tchn}/J

Stock number: 041116
Product name: R26-hKCNJ2
Research areas: Cell Biology Research, Developmental Biology Research, Research Tools

Description

R26-hKCNJ2 mice contain a Cre-inducible human KCNJ2 gene with a ubiquitously expressed synthetic CAG promoter inserted into the Gt(ROSA)26Sor locus. These mice may be useful when studying fibroblast bioelectricity in tissue regeneration, offering novel therapeutic avenues for hair loss treatment.

Detailed description

R26-hKCNJ2 mice contain a Cre-inducible human KCNJ2 gene with a ubiquitously expressed synthetic CAG promoter inserted into the Gt(ROSA)26Sor locus. A floxed STOP cassette, containing a neo cassette, prevents expression of the KCNJ2 gene in the absence of Cre recombinase. After removal of the loxP-flanked STOP cassette, KCNJ2 is produced in Cre-expressing cells.

KCNJ2 encodes an inward-rectifier type potassium channel found to be upregulated in patients with congenital generalized hypertrichosis terminalis (CGHT), a rare genetic disorder characterized by excessive hair growth. Mechanistically, KCNJ2 promotes hair growth by inducing fibroblast membrane hyperpolarization, which enhances fibroblast responsiveness to Wnt signaling in a manner dependent on decreased intracellular calcium levels. KCNJ2-induced hyperpolarization has been found to promote hair regrowth in an androgenetic alopecia (AGA) mouse model and preserved regenerative potential in aged mice.

When bred to Pdgfra-creER^TM (Stock No. 018280), with tamoxifen-inducible, Cre-activity in fibroblasts, KCNJ2 overexpression results in Pdgfra-CreER;R26-hKCNJ2 mice undergoing two hair cycles in a 40-day period. These mice developed significantly longer hair shafts across all hair types when measured during the telogen phase, mirroring the excessive hair growth phenotype observed in CGHT patients.

Development

An sgRNA (ggcattctacacgttattgc) was designed to target the Gt(ROSA)26Sor gene for insertion of a CAG promoter upstream of a loxP-flanked neomycin resistance (neo) cassette and a human potassium inwardly-rectifying channel, subfamily J, member 2 (KCNJ2) coding sequence. The sgRNA, Cas9 nuclease, and a donor DNA vector were introduced into the cytoplasm of zygotes derived from C57BL/6J mice and embryos were transferred to pseudopregnant females. R26-hKCNJ2 pups were identified by Sanger sequencing and PCR, and founder mice were further bred to C57BL/6NCrl mice for three generation to develop the colony (see SNP note below). It is unknown if off-target CRISPR sites are present. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6NJ oocytes (Stock No. 005304).

In 2026, A 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. One of the 43 markers throughout the genome was segregating with an unknown source on Chromosome 12. Also, genotyping at The Jackson Laboratory identified the presence of an ampicillin resistance gene (AMP) that is segregating with the R26-hKCNJ2 allele.

Allele

Symbol: Gt(ROSA)26Sor^{em1(CAG-KCNJ2)Tchn}
Name: endonuclease-mediated mutation 1, Ting Chen
MGI accession ID: MGI:8250827
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Inserted expressed sequence
Synonyms: R26-hKCNJ2
Marker symbol: Gt(ROSA)26Sor
Marker name: gene trap ROSA 26, Philippe Soriano
Marker synonyms: beta geo; Gtrgeo26; Gtrosa26; R26; ROSA26; SETD5-AS1; Thumpd3as1
Chromosome: 6
Strain of origin: C57BL/6J
Molecular note: An sgRNA (ggcattctacacgttattgc) was designed to target the Gt(ROSA)26Sor gene for insertion of a CAG promoter upstream of a loxP-flanked neomycin resistance (neo) cassette and a human potassium inwardly-rectifying channel, subfamily J, member 2 (KCNJ2) coding sequence.