C57BL/6N-Camk2d^em1Rlev/Mmjax

Stock number: 041057
Product name: Camk2d^Cys273S
Research areas: Cardiovascular Research, Cell Biology Research, Neurobiology Research

Description

Camk2d^Cys273S knock-in (KI) mice express a mutant CAMKIIδ that has an amino acid substitution of cysteine to a serine at residue 273 to prevent disulfide formation between the Cys273 and Cys290 residues. These mice may be useful when studying the regulatory role of CAMKIIδ in cardiac function and disease.

Detailed description

Camk2d codes for one of the calcium/calmodulin-dependent protein kinase type 2 (CAMK2) family isoforms. CAMKIIδ is expressed in the heart and has been associated with cardiac development and function. Oxidative stress may result in CAMKIIδ dysregulation and ultimately lead to cardiac failure. Specifically, oxidization at cysteine (Cys273/Cys290) residues and disulfide formation in in CAMKIIδ's regulatory domain results in calcium/calmodulin independent activity. These Camk2d^Cys273S knock-in (KI) mice express a mutant CAMKIIδ that has an amino acid substitution of cysteine to a serine at residue 273 to prevent disulfide formation between the Cys273 and Cys290 residues.

Homozygous mice are viable and fertile with no over phenotype. Camk2d^Cys273S KI mice are less suspectable to cardiac dysfunction after ischemia-reperfusion injury. These mice may be useful when studying the regulatory role of CAMKIIδ in cardiac function and disease.

Development

The Camk2d^Cys273S knock-in allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. A single guide RNA (AGTGACTTACACAGATCCAT) and a single-strand oligo donor template was used to introduce a point mutation that produces an amino acid substitution of cysteine to serine at position 273 (Cys273S) in the calcium/calmodulin-dependent protein kinase II, delta (Camk2d) gene on chromosome 3. The gRNAs, donor template, and CAS9 nuclease were introduced into the cytoplasm of zygotes derived from C57BL/6N mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The resulting Camk2d^Cys273S mice were backcrossed to C57BL/6N background for at least 5 generations by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish a live colony, an aliquot of frozen sperm was used to fertilize C57BL/6NJ oocytes.

Allele

Symbol: Camk2d^em1Rlev
Name: endonuclease-mediated mutation 1, Robert Levine
MGI accession ID: MGI:8242739
Generation method: Endonuclease-mediated
Attributes: Not Applicable
Marker symbol: Camk2d
Marker name: calcium/calmodulin-dependent protein kinase II, delta
Marker synonyms: 2810011D23Rik; 8030469K03Rik; CaMK II; CAMK1; Camk2; CAMKD; Camki; MGC:60852; RATCAMKI
Chromosome: 3
Strain of origin: C57BL/6N
Molecular note: Using CRISPR/Cas9 endonuclease-mediated genome editing, a single guide RNA (AGTGACTTACACAGATCCAT) and a single-strand oligo donor template was used to introduce a point mutation that produces an amino acid substitution of cysteine to serine at position 273 (Cys273S) in the calcium/calmodulin-dependent protein kinase II, delta (Camk2d) gene.