C57BL/6-Mog^{em1(icre)Lusu}/J

Stock number: 041041
Product name: Mog-IRES-iCre
Research areas: Neurobiology Research, Research Tools

Description

Mog-IRES-iCre knock-in mice have an icre recombinase gene inserted immediately upstream of the 3' UTR of the Mog gene. When these mice are bred with mice containing a loxP-flanked sequence of interest, Cre-mediated recombination will result in deletion of the floxed sequences in the Mog-expressing cells of the offspring. These mice may be useful for studying myelin formation and maintenance.

Of note, the donating laboratory has also made a tamoxifen-inducible Mog-IRES-iCre/ERT2 mouse line available as Stock No. 041042.

Detailed description

Myelin oligodendrocyte glycoprotein, coded by Mog, is a protein that is highly expressed in myelinating oligodendrocytes. Mog-IRES-iCre knock-in (KI) mice have an IRES followed by a codon-improved recombinase (icre) gene inserted into the 3' UTR, while retaining endogenous Mog expression. This insertion is designed to have the endogenous promoter/enhancer elements direct icre expression to MOG-positive cells. When bred with mice containing a loxP-flanked sequence of interest, Cre-mediated recombination will result in deletion of the floxed sequences in the Mog-expressing cells of the offspring.

Heterozygous mice are viable and fertile with no overt phenotype. Homozygous mice have not been generated by the donating laboratory to date (August 2025). The donating investigator reports iCre recombinase expression/activity recapitulates endogenous expression patterns in Mog-expressing cells. The donating investigator did not examine iCre expression in tissues other than the brain, optic nerve and spinal cord.

Of note, the donating laboratory has also made a tamoxifen-inducible Mog-IRES-iCre/ERT2 mouse line available as Stock No. 041042.

Development

The Mog-IRES-iCre knock-in allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. A single guide RNA (GGAAUCUGUCCACAGCAAAG) was used to introduce an internal ribosome entry site (IRES) followed by a codon-improved Cre recombinase (iCre) into the 3' UTR, immediately after the endogenous stop codon of the myelin oligodendrocyte glycoprotein (Mog) gene on Chromosome 17 (NM_010814). The sgRNA, ssDNA and the Cas9 nuclease were introduced into the cytoplasm of zygotes derived from C57BL/6J (Stock No. 000664) mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The donating investigator reported that the resulting Mog-IRES-iCre knock-in mice were bred to C57BL/6 mice for at least 5 generations prior to sending to The Jackson Laboratory in 2025 (see SNP results below). To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6NJ oocytes (Stock No. 005304).

In 2025, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. The 43 markers throughout the genome suggested a C57BL/6 genetic background. All 5 markers that determine C57BL/6J from C57BL/6N were found to be C57BL/6N. These data suggest that the mice sent to The Jackson Laboratory Repository were on a C57BL/6N genetic background.

Allele

Symbol: Mog^{em1(icre)Lusu}
Name: endonuclease-mediated mutation 1, Lu Sun
MGI accession ID: MGI:8242761
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing
Marker symbol: Mog
Marker name: myelin oligodendrocyte glycoprotein
Marker synonyms: B230317G11Rik; BTN6; BTNL11; MOGIG2; NRCLP7
Chromosome: 17
Strain of origin: C57BL/6J
Molecular note: Using CRISPR/Cas9 endonuclease-mediated genome editing, a single guide RNA (GGAAUCUGUCCACAGCAAAG) was used to introduce an internal ribosome entry site (IRES) followed by a codon-improved Cre recombinase (iCre) into the 3' UTR, immediately after the endogenous stop codon of the myelin oligodendrocyte glycoprotein (Mog) gene