C57BL/6J-Dync1h1^em1Shzb/Mmjax

Stock number: 040945
Product name: Dync1h1^P3018S
Research areas: Developmental Biology Research, Neurobiology Research

Description

Dync1h1^P3018S mice harbor a P3018S mutation in the Dync1h1 gene; this mutation is a patient-specific point mutation within the third functional ATPase domain of this dynein protein. These mice may be useful for studying neurodegenerative and neurodevelopmental disorders, such as Charcot-Marie-Tooth disease (axonal, type 2O).

Detailed description

The dynein cytoplasmic 1 heavy chain 1 (Dync1h1) gene codes for a subunit of the cytoplasmic dynein complex. Dyneins are microtubule-activated ATPases that play a role in intracellular motility, including retrograde axonal transport, and neural development. Mutations in this gene are associated with a type of Charcot-Marie-Tooth disease (axonal, type 2O), Cortical dysplasia and a form of spinal muscular atrophy known as SMA-lower extremity predominant (SMA-LED). These Dync1h1^P3018S mice harbor a point mutation in the Dync1h1 gene, resulting in a proline to serine amino acid substitution (P3018S) within the third functional ATPase domain of the protein. This missense mutation has been identified in a human patient that presented with cognitive and motor impairment.

Heterozygous mice are viable and fertile; homozygous mice are embryonic lethal. Heterozygous mice demonstrate increased activity in 3-chamber and y-maze assays, with Dync1h1^P3018S females showing a more robust phenotype. At 6 months of age, Dync1h1^P3018S heterozygotes have a higher metabolic rate and are significantly leaner with lower fat mass compared to wildtype controls. These mice may be useful for studying neurodegenerative and neurodevelopmental disorders.

Development

The Dync1h1^P3018S allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs (TGCCTCCTCACCTCTCGATG AGG and AGTGACCCTCGATGGAGTCC AGG) were used to target exon 46 of the dynein cytoplasmic 1 heavy chain 1 (Dync1h1) on chromosome 12. Dync1h1 transcript Dync1h1-201 (ENSMUST00000018851.14) was used as reference for the exon number and the guide sequences. The sgRNAs, donor DNA harboring the c9052C>T point mutation (aa.P3018S), and Cas9 nuclease were introduced into the cytoplasm of zygotes derived from C57BL/6J mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The resulting Dync1h1^P3018S mice were crossed to C57BL/6J mice for at least 2 generations by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Dync1h1^em1Shzb
Name: endonuclease-mediated mutation 1, Bridget Shafit-Zagardo
MGI accession ID: MGI:8255226
Generation method: Endonuclease-mediated
Attributes: Humanized sequence
Synonyms: Dync1h1(P3018S)
Marker symbol: Dync1h1
Marker name: dynein cytoplasmic 1 heavy chain 1
Marker synonyms: 9930018I23Rik; CDCBM13; CMT2O; DHC1; DHC1a; Dnch1; Dnchc1; DNCL; Dnec1; DNECL; DYHC; dynein heavy chain, retrograde transport; HL-3; Loa; MAP1C; mKIAA0325; p22; SMALED1; Swl
Chromosome: 12
Strain of origin: C57BL/6J
Molecular note: Using CRIPSR/Cas9 mediated genome editing, a point mutation c9052C > T in the Dync1h1 gene was generated. This mutation is a patient-specific de novo point mutation found within the third functional ATPase domain.