C57BL/6J-Lmx1b^{em1(cre)Jgeer}/J

Stock number: 040885
Product name: Lmx1b-2A-Cre
Research areas: Developmental Biology Research, Neurobiology Research, Research Tools

Description

Lmx1b-2A-Cre knock-in mice are designed to have P2A-Cre sequence inserted immediately before the stop codon of the LIM homeobox transcription factor 1 beta (Lmx1b) gene. Mice are useful for targeting Lmx1b-expressing cells in adult animals and studying Lmx1b-dependent patterning during mouse development.

Of note, a strain is available expressing tamoxifen-inducible Cre recombinase from the Lmx1b locus: Lmx1b-IREScreER^T2 knock-in (Stock No. 031289).

Detailed description

Lmx1b-2A-Cre knock-in mice are designed to have P2A-Cre sequence inserted immediately before the stop codon of the LIM homeobox transcription factor 1 beta (Lmx1b) gene. LMX1B is a transcription factor that is essential for the normal development of dorsal limb structures, the glomerular basement membrane, the anterior segment of the eye, and dopaminergic and serotonergic neurons, as well as maintaining the glutamatergic identity of several excitatory neuron populations in the brainstem and spinal cord. The endogenous Lmx1b promoter directs expression of Cre recombinase to neuronal subpopulations in the adult brain and developmental precursors in the brain, spinal cord, limb-buds, and other tissues. The presence of P2A-Cre cassette allows for expression of LMX1B and Cre. Both heterozygous and homozygous mice are viable and fertile. When these mice are bred with mice containing loxP-flanked sequence, Cre-mediated recombination will result in deletion of the loxP-flanked sequences.

Of note, a strain is available expressing tamoxifen-inducible Cre recombinase from the Lmx1b locus: Lmx1b-IREScreER^T2 knock-in (Stock No. 031289).

Development

crRNA and tracrRNA were annealed to create a cr:tracrRNA duplex gRNA that was complexed with spCas9 to create a Cas9_RNP. The guide (AGCTCTGCATGGAGTAGAGC) was designed to cut near the stop codon of the LIM homeobox transcription factor 1 beta (Lmx1b) gene and to insert a viral 2A oligopeptide (2A) self-cleaving peptide fused to a Cre recombinase (cre) sequence via homologous recombination (based on Lmx1b-201 ENSMUST00000041730.12). Cas9_RNP's and single-stranded DNA (ssDNA) were injected into the pronuclei of C57BL/6J zygotes. Embryos were transferred to pseudopregnant females. Correctly targeted Lmx1b-2A-Cre pups were identified by PCR and sequencing. Mice were further bred to C57BL/6J mice (Stock No. 000664) for at least 6 generations by the donating laboratory to remove off-target CRISPR sites. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Lmx1b^{em1(cre)Jgeer}
Name: endonuclease-mediated mutation 1, Joel C Geerling
MGI accession ID: MGI:7384278
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing
Synonyms: Lmx1b-2A-Cre
Marker symbol: Lmx1b
Marker name: LIM homeobox transcription factor 1 beta
Marker synonyms: FSGS10; GENA 191; Icst; LMX1.2; NPS1
Chromosome: 2
Strain of origin: C57BL/6J
Molecular note: The guide (AGCTCTGCATGGAGTAGAGC) was designed to cut near the stop codon of the LIM homeobox transcription factor 1 beta (Lmxb1) gene and to insert a viral 2A oligopeptide (2A) self-cleaving peptide fused to a Cre recombinase sequence.