C57BL/6J-Hexa^em1(HEXA)Rlp/J

Stock number: 040823
Product name: HEXA c.805G
Research areas: Metabolism Research, Mouse/Human Gene Homologs

Description

HEXA c.805G knock-in mice have exon 7 of the endogenous Hexa gene replaced with a wildtype human exon 7 (c.805G). These mice are useful as a wildtype control for HEXA c.805A knock-in/knock-out mice (Stock No. 040822) used for studying Late-onset Tay-Sachs (LOTS) disease.

Detailed description

HEXA c.805G knock-in mice have exon 7 of the endogenous hexosaminidase A (Hexa) gene replaced with a wildtype human exon 7 (c.805G). Hexa encodes a preproprotein that is proteolytically processed to generate the alpha subunit of the lysosomal enzyme beta-hexosaminidase A. c.805A mutations have been found in patients with Late-onset Tay-Sachs (LOTS) disease.

LOTS disease is a lysosomal storage disorder most commonly caused by a point mutation (c.805G>A) in the HEXA gene. Deficiency of beta-hexosaminidase A results in the lysosomal accumulation of its substrate, GM2 ganglioside, a glycosphingolipid found in the cell membranes of neurons. This accumulation can build up to toxic levels in the brain and spinal cord and progressively destroys neurons. Null mutations in HEXA result in the complete loss of enzymatic activity and lead to an acute infantile-onset neurodegenerative disease. Signs and symptoms start to show up at 3 to 6 months of age. As the disease progresses, development slows, and muscles begin to weaken. Over time, this leads to seizures, vision and hearing loss, paralysis, and other major issues. Children with a an infantile-onset form of Tay-Sachs disease typically live only a few years. Unlike the more severe infantile-onset and juvenile-onset forms of Tay-Sachs disease, LOTS typically does not impact life expectancy and progresses much more slowly.

These HEXA c.805G mice carrying a human exon 7 are normal with no overt phenotype. Homozygous mice are viable and fertile. This strain serves as a wildtype control for HEXA c.805A knock-in mice (Stock No. 040822) which have exon 7 of the endogenous Hexa gene replaced with a mutant human exon 7 (c.805A) found in patients with LOTS disease.

Development

sgRNAs (GACGAGTGTTCTAAAATTCA and CTAGAGGGAGTTCCTTCCAT) were designed target intron sequences flanking exon 7 of the endogenous hexosaminidase A (Hexa) gene. A donor ssDNA template containing a wildtype human HEXA exon 7 was designed to retain a wildtype guanine (G) residue in the human exon 7 sequence. sgRNA, the cas9 protein, and the mutant ssDNA template were introduced into C57BL/6J-derived embryos with well-recognized pronuclei. Injected embryos were transferred to pseudopregnant females. Resulting HEXA c.805G knock-in/knock-out mice were identified by PCR and sequencing, and correctly targeted offspring were further bred to C57BL/6J mice (Stock No. 000664) for at least 1 generation by the donating laboratory to remove any off-target CRISPR sites. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Hexa^em1(HEXA)Rlp
Name: endonuclease-mediated mutation 1, Richard Proia
MGI accession ID: MGI:8243293
Generation method: Endonuclease-mediated
Attributes: Inserted expressed sequence; Humanized sequence
Synonyms: HEXA c.805G
Marker symbol: Hexa
Marker name: hexosaminidase A
Marker synonyms: Hex-1; TSD
Chromosome: 9
Strain of origin: C57BL/6J
Molecular note: sgRNAs (GACGAGTGTTCTAAAATTCA and CTAGAGGGAGTTCCTTCCAT) were designed target intron sequences flanking exon 7 of the endogenous hexosaminidase A (Hexa) gene. A donor ssDNA template containing a wildtype human HEXA exon 7 was designed to retain a wildtype guanine (G) residue in the human exon 7 sequence.