STOCK Pou2af1^em1Dtan/J

Stock number: 040810
Product name: OCA-B-3xmCherry
Research areas: Cell Biology Research, Research Tools

Description

OCA-B-3xmCherry knock-in mice have a P2A self-cleaving peptide and three mCherry sequences inserted immediately before the stop codon and 3' UTR of the Pou2af1 gene. These mice may be useful for identifying and studying antiviral memory recall responses and germinal center responses.

Detailed description

OCA-B-3xmCherry knock-in mice have a P2A self-cleaving peptide and three mCherry red fluorescence sequences inserted immediately before the stop codon and 3' UTR of the POU domain, class 2, associating factor 1 (Pou2af1) gene. The insertion does not affect endogenous gene expression. The Pou2af1 gene, also called Oct coactivator from B cells (OCA-B), encodes a transcriptional coactivator that is essential for the response of B-cells to antigens and is required for the formation of germinal centers. Also, expressed in T cells, OCA-B promotes CD4⁺ memory formation and marks memory precursor cells. In these OCA-B-3xmCherry, OCA-B protein is readily detectable in peripheral blood B cells from hemizygous reporter mice and B and T cells from homozygous reporter mice. Specifically, mCherry expression is detected in the bone marrow, peritoneal cavity, spleen, and lymph nodes. Total thymocytes express little OCA-B, while expression is detected in developing, immature, and recirculating B cell populations and CD4⁺ central memory precursor cells.

mCherry fluorescence is detectable by fluorescence microscopy and flow cytometry.

Development

A sgRNA (CTATTTCTAGCTCTAAAACCCACGGAGAGGGTGTGGTTGCCTATAGTGAGTCGTATTA) was designed to insert a P2A self-cleaving peptide and three mCherry red fluorescence sequences immediately before the stop codon and 3' UTR of the POU domain, class 2, associating factor 1 (Pou2af1) gene [based on ENSEMBL Transcript ID: Pou2af1-201 (NM 011136) ENSMUSE00000351521]. sgRNA, the cas9 protein, and a donor plasmid were introduced into the cytoplasm of C57BL/6N-derived fertilized eggs with well-recognized pronuclei. Injected embryos were transferred to pseudopregnant females. Resulting OCA-B-3xmCherry knock-in mice were identified by PCR and sequencing, and correctly targeted offspring were further bred to C57BL/6J mice (Stock No. 000664) for at least 5 generations by the donating laboratory to remove any off-target CRISPR sites (see SNP note below). Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

In 2025, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the rederived living colony at The Jackson Laboratory Repository. At least 7 of the 43 markers throughout the genome were segregating with an unknown source. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed genetic background.

Allele

Symbol: Pou2af1^em1Dtan
Name: endonuclease-mediated mutation 1, Dean Tantin
MGI accession ID: MGI:8224857
Generation method: Endonuclease-mediated
Attributes: Reporter
Synonyms: Pou2af1-3×mCherry
Marker symbol: Pou2af1
Marker name: POU domain, class 2, associating factor 1
Marker synonyms: BOB.1; BOB1; Bob-1; OBF.1; OBF1; OBF-1; OCAB; OCA-B
Chromosome: 9
Strain of origin: C57BL/6N
Molecular note: A sgRNA (CTATTTCTAGCTCTAAAACCCACGGAGAGGGTGTGGTTGCCTATAGTGAGTCGTATTA) was designed to insert a P2A self-cleaving peptide and three mCherry red fluorescence sequences immediately before the stop codon and 3' UTR of the Pou2af1 gene.