C57BL/6J-Creb5^em2Abl/J

Stock number: 040791
Product name: Creb5^{3XHA-P2A-tdTomato}
Strain synonyms: Creb5^HA-tdTomato
Research areas: Cell Biology Research, Internal/Organ Research, Research Tools

Description

Creb5^{3XHA-P2A-tdTomato} mice have 3xHA tags fused in-frame to the C-terminal of the Creb5 gene followed by a P2A ribosome-skipping peptide and a tdTomato sequence. These mice may be useful when studying the development of synovial joints and intervertebral disks and for isolating Creb5-expressing cells from either developing or mature synovial joints or intervertebral disks.

Detailed description

Creb5^{3XHA-P2A-tdTomato} mice have 3x hemagglutinin (HA) tags fused in-frame to the C-terminal of the cAMP responsive element binding protein 5 (Creb5) gene followed by a P2A ribosome-skipping peptide and a tdTomato sequence. Creb5 encodes a transcription factor involved in the expression of signaling molecules that both direct the formation of synovial joints and guide perichondrial tissue to form articular cartilage instead of bone in part by inducing expression of molecules that block a Wnt5a autoregulatory loop in the perichondrium. Mice that are heterozygous for this allele are viable and fertile.

At embryonic day 14.5, tdTomato fluorescence is evident in ear progenitors, a ring of tissue surrounding the eyes, the forebrain, connective tissues in the head, in the progenitors of intervertebral discs, the joint forming regions, and also in the heart. In the knee forming region, tdTomato is both expressed in the joint interzone and in peripheral tissues that lie adjacent to the joint interzone. After the knee is fully formed (by embryonic Day 18.5) tdTomato is expressed in the superficial cells of the articular cartilage, superficial cells of the meniscus, synovial lining cells, enthesis and sheath cells of the patellar tendon and ligaments.

TdTomato fluorescence is detectable either by direct fluorescence, immunofluorescence, or FACS.

Development

A Guide RNA (UCCUAUUCUUUAAAAGGCAU) was designed to target the stop codon of the cAMP responsive element binding protein 5 (Creb5) gene for insertion of 3x hemagglutinin (HA) tags followed by a P2A ribosome-skipping peptide and a tdTomato sequence (based on ENSEMBL Transcript Creb5-202: ENSMUST00000203487.3). Guide RNA, Cas9 protein, and double-stranded closed circular Creb5^{3XHA-P2A-tdTomato} targeting vector were injected into the cytoplasm of C57BL/6J-derived embryos with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females and resulting Creb5^{3XHA-P2A-tdTomato} pups were identified by PCR. A founder male was bred to a C57BL/6J female (Stock No. 000664) for germline transmission. Mice were further bred to C57BL/6J mice for at least 6 generations by the donating laboratory to remove any off-target CRISPR changes. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Creb5^em2Abl
Name: endonuclease-mediated mutation 2, Andrew Lassar
MGI accession ID: MGI:8264564
Generation method: Endonuclease-mediated
Attributes: Reporter; Epitope tag
Synonyms: Creb53XHA-P2A- tdTomato
Marker symbol: Creb5
Marker name: cAMP responsive element binding protein 5
Marker synonyms: 9430076C15Rik; CREB-5; CREBPA; CRE-BPA; D430026C09Rik; RGD1566107
Chromosome: 6
Strain of origin: C57BL/6J
Molecular note: A Guide RNA (UCCUAUUCUUUAAAAGGCAU) was designed to target the stop codon of the cAMP responsive element binding protein 5 (Creb5) gene for insertion of 3x hemagglutinin (HA) tags followed by a P2A ribosome-skipping peptide and a tdTomato sequence.